EMAIL THIS PAGE TO A FRIEND

SPATA31A7

SPATA31 subfamily A, member 7

Synonyms: C9orf36A FAM75A7
Species: Human SPATA31A7(26165)
UniProtKB ID: Q8IWB4, Q5TZK4, Q9Y4Q5
Gene ID:
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015667 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111171 MISSION® esiRNA esiRNA human FAM75A5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015667 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348291 predicted 1995
2 SASI_Hs01_00183913 predicted 3878
3 SASI_Hs02_00348292 predicted 1926
4 SASI_Hs02_00348293 predicted 1776
5 SASI_Hs02_00348294 predicted 904
6 SASI_Hs01_00183914 predicted 1099
7 SASI_Hs01_00183917 predicted 2733
8 SASI_Hs02_00348295 predicted 1649
9 SASI_Hs01_00183918 predicted 1380
10 SASI_Hs02_00348296 predicted 2658
11 SASI_Hs01_00183912 predicted 913
12 SASI_Hs01_00183915 predicted 1105
13 SASI_Hs01_00183916 predicted 3789
14 SASI_Hs01_00183919 predicted 1069
15 SASI_Hs01_00183920 predicted 1116
16 SASI_Hs01_00183921 predicted 1764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015667
SPATA31A7 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily A, member 7
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-351s1c1
Sequence:CCGGCACCTTGACAAAGGTGACTTTCTCGAGAAAGTCACCTTTGTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-1760s1c1
Sequence:CCGGCCAGGAAAGTTTGACATCCATCTCGAGATGGATGTCAAACTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-796s1c1
Sequence:CCGGCACATGAGGATTTGGTGGCTTCTCGAGAAGCCACCAAATCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-787s1c1
Sequence:CCGGGCTTGTCTCCACATGAGGATTCTCGAGAATCCTCATGTGGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-1390s1c1
Sequence:CCGGGCCCAATTCAAAGGGAGACTACTCGAGTAGTCTCCCTTTGAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015667.1-1761s1c1
Sequence:CCGGCAGGAAAGTTTGACATCCATTCTCGAGAATGGATGTCAAACTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015667
SPATA31A7 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily A, member 7
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-351s1c1
Sequence:CCGGCACCTTGACAAAGGTGACTTTCTCGAGAAAGTCACCTTTGTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-1760s1c1
Sequence:CCGGCCAGGAAAGTTTGACATCCATCTCGAGATGGATGTCAAACTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-796s1c1
Sequence:CCGGCACATGAGGATTTGGTGGCTTCTCGAGAAGCCACCAAATCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-787s1c1
Sequence:CCGGGCTTGTCTCCACATGAGGATTCTCGAGAATCCTCATGTGGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-1390s1c1
Sequence:CCGGGCCCAATTCAAAGGGAGACTACTCGAGTAGTCTCCCTTTGAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015667.1-1761s1c1
Sequence:CCGGCAGGAAAGTTTGACATCCATTCTCGAGAATGGATGTCAAACTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015667
SPATA31A7 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily A, member 7
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-351s1c1
Sequence:CCGGCACCTTGACAAAGGTGACTTTCTCGAGAAAGTCACCTTTGTCAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-1760s1c1
Sequence:CCGGCCAGGAAAGTTTGACATCCATCTCGAGATGGATGTCAAACTTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-796s1c1
Sequence:CCGGCACATGAGGATTTGGTGGCTTCTCGAGAAGCCACCAAATCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-787s1c1
Sequence:CCGGGCTTGTCTCCACATGAGGATTCTCGAGAATCCTCATGTGGAGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015667.1-1390s1c1
Sequence:CCGGGCCCAATTCAAAGGGAGACTACTCGAGTAGTCTCCCTTTGAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015667.1-1761s1c1
Sequence:CCGGCAGGAAAGTTTGACATCCATTCTCGAGAATGGATGTCAAACTTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks