EMAIL THIS PAGE TO A FRIEND

SPATA31B1

SPATA31 subfamily B, member 1

Synonyms: C9orf36B FAM75B bA388B24.2
Species: Human SPATA31B1(404770)
UniProtKB ID: Q5VZV4
Gene ID:
11 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098807 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153051 MISSION® esiRNA esiRNA human FAM75B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098807 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319944 predicted 283
2 SASI_Hs02_00319945 predicted 281
3 SASI_Hs02_00319946 predicted 304
4 SASI_Hs02_00319947 predicted 545
5 SASI_Hs02_00319948 predicted 535
6 SASI_Hs02_00319949 predicted 706
7 SASI_Hs02_00319950 predicted 717
8 SASI_Hs02_00319951 predicted 655
9 SASI_Hs02_00319952 predicted 724
10 SASI_Hs02_00319953 predicted 79
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098807
SPATA31B1 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily B, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-194s21c1
Sequence:CCGGGTCAGCTCTCTGGTCCAGAACCTCGAGGTTCTGGACCAGAGAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-543s21c1
Sequence:CCGGTCCACTCTGATAACTCCATTTCTCGAGAAATGGAGTTATCAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-314s21c1
Sequence:CCGGCAGATCCTCGAATCAAGCATCCTCGAGGATGCTTGATTCGAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-280s21c1
Sequence:CCGGGATGCTGCTCCCATTATCTACCTCGAGGTAGATAATGGGAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098807
SPATA31B1 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily B, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-194s21c1
Sequence:CCGGGTCAGCTCTCTGGTCCAGAACCTCGAGGTTCTGGACCAGAGAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-543s21c1
Sequence:CCGGTCCACTCTGATAACTCCATTTCTCGAGAAATGGAGTTATCAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-314s21c1
Sequence:CCGGCAGATCCTCGAATCAAGCATCCTCGAGGATGCTTGATTCGAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-280s21c1
Sequence:CCGGGATGCTGCTCCCATTATCTACCTCGAGGTAGATAATGGGAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098807
SPATA31B1 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily B, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-194s21c1
Sequence:CCGGGTCAGCTCTCTGGTCCAGAACCTCGAGGTTCTGGACCAGAGAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-543s21c1
Sequence:CCGGTCCACTCTGATAACTCCATTTCTCGAGAAATGGAGTTATCAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-314s21c1
Sequence:CCGGCAGATCCTCGAATCAAGCATCCTCGAGGATGCTTGATTCGAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098807.1-280s21c1
Sequence:CCGGGATGCTGCTCCCATTATCTACCTCGAGGTAGATAATGGGAGCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks