EMAIL THIS PAGE TO A FRIEND

SPATA31C1

SPATA31 subfamily C, member 1

Synonyms: FAM75C1 SPATA31C2
Species: Human SPATA31C1(441452)
UniProtKB ID: P0DKV0
Gene ID:
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_212238 Rosetta Predictions human pricing
XM_212241 Rosetta Predictions human pricing
XR_041344 Rosetta Predictions human pricing
XR_041345 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_212238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265011 predicted 630
2 SASI_Hs01_00265012 predicted 1789
3 SASI_Hs01_00265013 predicted 1337
4 SASI_Hs01_00265014 predicted 220
5 SASI_Hs01_00265015 predicted 1338
6 SASI_Hs01_00265016 predicted 1212
7 SASI_Hs01_00265017 predicted 1737
8 SASI_Hs01_00265018 predicted 1814
9 SASI_Hs01_00265019 predicted 1029
10 SASI_Hs01_00265020 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_212241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268389 predicted 1462
2 SASI_Hs01_00268390 predicted 2162
3 SASI_Hs01_00268391 predicted 2161
4 SASI_Hs01_00268392 predicted 2035
5 SASI_Hs01_00268393 predicted 1933
6 SASI_Hs01_00268394 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526558 predicted 3351
2 SASI_Hs02_00526559 predicted 1927
3 SASI_Hs02_00526560 predicted 1475
4 SASI_Hs02_00526561 predicted 1171
5 SASI_Hs02_00526562 predicted 168
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526563 predicted 1452
2 SASI_Hs02_00526564 predicted 1151
3 SASI_Hs02_00526565 predicted 173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145124
SPATA31C1 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily C, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-1717s21c1
Sequence:CCGGGTGACTCAGGAAGTGATTTATCTCGAGATAAATCACTTCCTGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-2920s21c1
Sequence:CCGGACTCTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-1742s21c1
Sequence:CCGGACGCACAGAGAGGAATCATATCTCGAGATATGATTCCTCTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-225s21c1
Sequence:CCGGCTTGTCTCCCAGCGTCATCTTCTCGAGAAGATGACGCTGGGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-2077s21c1
Sequence:CCGGTTTCATCCTTGTCCCTTATACCTCGAGGTATAAGGGACAAGGATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145124
SPATA31C1 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily C, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-1717s21c1
Sequence:CCGGGTGACTCAGGAAGTGATTTATCTCGAGATAAATCACTTCCTGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-2920s21c1
Sequence:CCGGACTCTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-1742s21c1
Sequence:CCGGACGCACAGAGAGGAATCATATCTCGAGATATGATTCCTCTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-225s21c1
Sequence:CCGGCTTGTCTCCCAGCGTCATCTTCTCGAGAAGATGACGCTGGGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-2077s21c1
Sequence:CCGGTTTCATCCTTGTCCCTTATACCTCGAGGTATAAGGGACAAGGATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145124
SPATA31C1 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily C, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-1717s21c1
Sequence:CCGGGTGACTCAGGAAGTGATTTATCTCGAGATAAATCACTTCCTGAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-2920s21c1
Sequence:CCGGACTCTAGGAAGCCCAACTTAGCTCGAGCTAAGTTGGGCTTCCTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-1742s21c1
Sequence:CCGGACGCACAGAGAGGAATCATATCTCGAGATATGATTCCTCTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-225s21c1
Sequence:CCGGCTTGTCTCCCAGCGTCATCTTCTCGAGAAGATGACGCTGGGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145124.1-2077s21c1
Sequence:CCGGTTTCATCCTTGTCCCTTATACCTCGAGGTATAAGGGACAAGGATGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks