EMAIL THIS PAGE TO A FRIEND

SPATA31D1

SPATA31 subfamily D, member 1

Synonyms: FAM75D1
UniProtKB ID: Q6ZQQ2
Gene ID:
naked mole-rat(101705483) SPATA31 subfamily D, member 1
cow(101902246) SPATA31 subfamily D, member 1
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372120 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001670 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142691 predicted 4564
2 SASI_Hs01_00142692 predicted 4107
3 SASI_Hs01_00142693 predicted 4230
4 SASI_Hs02_00303867 predicted 3573
5 SASI_Hs01_00142694 predicted 3488
6 SASI_Hs01_00142695 predicted 1065
7 SASI_Hs01_00142696 predicted 910
8 SASI_Hs01_00142697 predicted 268
9 SASI_Hs01_00142698 predicted 3756
10 SASI_Hs01_00142699 predicted 4213
11 SASI_Hs01_00142700 predicted 1080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372120
SPATA31D1 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily D, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-3748s1c1
Sequence:CCGGCCAAGGACTTACTGACTAATTCTCGAGAATTAGTCAGTAAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-4109s1c1
Sequence:CCGGGAAGACCTCTTTGCAGTGGTTCTCGAGAACCACTGCAAAGAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372120.1-99s1c1
Sequence:CCGGCCTGACTCACATTGGTTGGATCTCGAGATCCAACCAATGTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372120.1-884s1c1
Sequence:CCGGCCAAGATATTTCGCAGGCCATCTCGAGATGGCCTGCGAAATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-275s1c1
Sequence:CCGGCAAAGGTTTCCCAGACTGGAACTCGAGTTCCAGTCTGGGAAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-3182s1c1
Sequence:CCGGCCTCGGTCATTCTTACCTTGTCTCGAGACAAGGTAAGAATGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-1816s1c1
Sequence:CCGGCCCTACTACCTAGTCCTCTATCTCGAGATAGAGGACTAGGTAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372120
SPATA31D1 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily D, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-3748s1c1
Sequence:CCGGCCAAGGACTTACTGACTAATTCTCGAGAATTAGTCAGTAAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-4109s1c1
Sequence:CCGGGAAGACCTCTTTGCAGTGGTTCTCGAGAACCACTGCAAAGAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372120.1-99s1c1
Sequence:CCGGCCTGACTCACATTGGTTGGATCTCGAGATCCAACCAATGTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372120.1-884s1c1
Sequence:CCGGCCAAGATATTTCGCAGGCCATCTCGAGATGGCCTGCGAAATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-275s1c1
Sequence:CCGGCAAAGGTTTCCCAGACTGGAACTCGAGTTCCAGTCTGGGAAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-3182s1c1
Sequence:CCGGCCTCGGTCATTCTTACCTTGTCTCGAGACAAGGTAAGAATGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-1816s1c1
Sequence:CCGGCCCTACTACCTAGTCCTCTATCTCGAGATAGAGGACTAGGTAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372120
SPATA31D1 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily D, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-3748s1c1
Sequence:CCGGCCAAGGACTTACTGACTAATTCTCGAGAATTAGTCAGTAAGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-4109s1c1
Sequence:CCGGGAAGACCTCTTTGCAGTGGTTCTCGAGAACCACTGCAAAGAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372120.1-99s1c1
Sequence:CCGGCCTGACTCACATTGGTTGGATCTCGAGATCCAACCAATGTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372120.1-884s1c1
Sequence:CCGGCCAAGATATTTCGCAGGCCATCTCGAGATGGCCTGCGAAATATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-275s1c1
Sequence:CCGGCAAAGGTTTCCCAGACTGGAACTCGAGTTCCAGTCTGGGAAACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-3182s1c1
Sequence:CCGGCCTCGGTCATTCTTACCTTGTCTCGAGACAAGGTAAGAATGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372120.1-1816s1c1
Sequence:CCGGCCCTACTACCTAGTCCTCTATCTCGAGATAGAGGACTAGGTAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks