EMAIL THIS PAGE TO A FRIEND

SPATA31D3

SPATA31 subfamily D, member 3

Synonyms: FAM75D3
UniProtKB ID: P0C874
Gene ID:
Rat(306725) SPATA31 subfamily D, member 3
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041532 Rosetta Predictions human pricing
XM_225147 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528135 predicted 4594
2 SASI_Hs02_00528136 predicted 4222
3 SASI_Hs02_00528137 predicted 4290
4 SASI_Hs02_00528138 predicted 4585
5 SASI_Hs02_00528139 predicted 4322
6 SASI_Hs02_00528140 predicted 4187
7 SASI_Hs02_00528141 predicted 4093
8 SASI_Hs02_00528142 predicted 4107
9 SASI_Hs02_00528143 predicted 4088
10 SASI_Hs02_00528144 predicted 4093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382537 predicted 1680
2 SASI_Rn02_00382538 predicted 1759
3 SASI_Rn02_00382539 predicted 504
4 SASI_Rn02_00382540 predicted 1065
5 SASI_Rn02_00382541 predicted 994
6 SASI_Rn02_00382542 predicted 830
7 SASI_Rn02_00382543 predicted 288
8 SASI_Rn02_00382544 predicted 670
9 SASI_Rn02_00382545 predicted 248
10 SASI_Rn02_00382546 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207416
SPATA31D3 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily D, member 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000165127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-550s1c1
Sequence:CCGGCCTACCACCTAGTCCTCTATTCTCGAGAATAGAGGACTAGGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-744s1c1
Sequence:CCGGCCAATCCTGTATTGGTCAGAACTCGAGTTCTGACCAATACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-960s1c1
Sequence:CCGGGCATTCATGGTCCATTAAATACTCGAGTATTTAATGGACCATGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-118s1c1
Sequence:CCGGCCAACTAAATTCCTCACGGAACTCGAGTTCCGTGAGGAATTTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207416
SPATA31D3 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily D, member 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000165127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-550s1c1
Sequence:CCGGCCTACCACCTAGTCCTCTATTCTCGAGAATAGAGGACTAGGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-744s1c1
Sequence:CCGGCCAATCCTGTATTGGTCAGAACTCGAGTTCTGACCAATACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-960s1c1
Sequence:CCGGGCATTCATGGTCCATTAAATACTCGAGTATTTAATGGACCATGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-118s1c1
Sequence:CCGGCCAACTAAATTCCTCACGGAACTCGAGTTCCGTGAGGAATTTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207416
SPATA31D3 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily D, member 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000165127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-550s1c1
Sequence:CCGGCCTACCACCTAGTCCTCTATTCTCGAGAATAGAGGACTAGGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-744s1c1
Sequence:CCGGCCAATCCTGTATTGGTCAGAACTCGAGTTCTGACCAATACAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-960s1c1
Sequence:CCGGGCATTCATGGTCCATTAAATACTCGAGTATTTAATGGACCATGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207416.1-118s1c1
Sequence:CCGGCCAACTAAATTCCTCACGGAACTCGAGTTCCGTGAGGAATTTAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks