EMAIL THIS PAGE TO A FRIEND

SPATA31D4

SPATA31 subfamily D, member 4

Synonyms: FAM75D4
Species: Human SPATA31D4(389761)
UniProtKB ID: Q6ZUB0
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207415 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145197 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145197 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145197 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_015253 Rosetta Predictions human pricing
XR_041533 Rosetta Predictions human pricing
XR_041534 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00487564 predicted 1117
2 SASI_Hs02_00487565 predicted 1097
3 SASI_Hs02_00487566 predicted 307
4 SASI_Hs02_00487567 predicted 4225
5 SASI_Hs02_00487568 predicted 4014
6 SASI_Hs02_00487569 predicted 4205
7 SASI_Hs02_00487570 predicted 4309
8 SASI_Hs02_00487571 predicted 2980
9 SASI_Hs02_00487572 predicted 1106
10 SASI_Hs02_00487573 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528145 predicted 731
2 SASI_Hs02_00528146 predicted 747
3 SASI_Hs02_00528147 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00528148 predicted 728
2 SASI_Hs02_00528149 predicted 744
3 SASI_Hs02_00528150 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207415
SPATA31D4 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily D, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207415.1-1208s1c1
Sequence:CCGGGCCAACATCATACAGCCTGTTCTCGAGAACAGGCTGTATGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4583s1c1
Sequence:CCGGCCCAGGAAGTTGAGGCATTTACTCGAGTAAATGCCTCAACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4174s1c1
Sequence:CCGGCCTAGCATAATGTGTGAAGAACTCGAGTTCTTCACACATTATGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4519s1c1
Sequence:CCGGGCTATCTTTGTTGGACAGAATCTCGAGATTCTGTCCAACAAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207415.1-84s1c1
Sequence:CCGGCTGACTCACATTGTTTGGATACTCGAGTATCCAAACAATGTGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-2894s1c1
Sequence:CCGGGCTTTATTTCTCAGGGAGATTCTCGAGAATCTCCCTGAGAAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207415.1-83s1c1
Sequence:CCGGCCTGACTCACATTGTTTGGATCTCGAGATCCAAACAATGTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207415.1-4224s1c1
Sequence:CCGGCCTGTCATCATCTGTGCAGAACTCGAGTTCTGCACAGATGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207415
SPATA31D4 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily D, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207415.1-1208s1c1
Sequence:CCGGGCCAACATCATACAGCCTGTTCTCGAGAACAGGCTGTATGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4583s1c1
Sequence:CCGGCCCAGGAAGTTGAGGCATTTACTCGAGTAAATGCCTCAACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4174s1c1
Sequence:CCGGCCTAGCATAATGTGTGAAGAACTCGAGTTCTTCACACATTATGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4519s1c1
Sequence:CCGGGCTATCTTTGTTGGACAGAATCTCGAGATTCTGTCCAACAAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207415.1-84s1c1
Sequence:CCGGCTGACTCACATTGTTTGGATACTCGAGTATCCAAACAATGTGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-2894s1c1
Sequence:CCGGGCTTTATTTCTCAGGGAGATTCTCGAGAATCTCCCTGAGAAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207415.1-83s1c1
Sequence:CCGGCCTGACTCACATTGTTTGGATCTCGAGATCCAAACAATGTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207415.1-4224s1c1
Sequence:CCGGCCTGTCATCATCTGTGCAGAACTCGAGTTCTGCACAGATGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207415
SPATA31D4 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily D, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207415.1-1208s1c1
Sequence:CCGGGCCAACATCATACAGCCTGTTCTCGAGAACAGGCTGTATGATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136929    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4583s1c1
Sequence:CCGGCCCAGGAAGTTGAGGCATTTACTCGAGTAAATGCCTCAACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4174s1c1
Sequence:CCGGCCTAGCATAATGTGTGAAGAACTCGAGTTCTTCACACATTATGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-4519s1c1
Sequence:CCGGGCTATCTTTGTTGGACAGAATCTCGAGATTCTGTCCAACAAAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134009    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207415.1-84s1c1
Sequence:CCGGCTGACTCACATTGTTTGGATACTCGAGTATCCAAACAATGTGAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207415.1-2894s1c1
Sequence:CCGGGCTTTATTTCTCAGGGAGATTCTCGAGAATCTCCCTGAGAAATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207415.1-83s1c1
Sequence:CCGGCCTGACTCACATTGTTTGGATCTCGAGATCCAAACAATGTGAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207415.1-4224s1c1
Sequence:CCGGCCTGTCATCATCTGTGCAGAACTCGAGTTCTGCACAGATGATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145197
SPATA31D4 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily D, member 4
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000418724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-2780s21c1
Sequence:CCAGGATGTTGGAAGCCCATATTAACTCGAGTTAATATGGGCTTCCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-1403s21c1
Sequence:CCGGTAGGCCAAACTACCAACTAAACTCGAGTTTAGTTGGTAGTTTGGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-2255s21c1
Sequence:CCGGGAGCATTCATGGTCCATTAAACTCGAGTTTAATGGACCATGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145197
SPATA31D4 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily D, member 4
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000418724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-2780s21c1
Sequence:CCAGGATGTTGGAAGCCCATATTAACTCGAGTTAATATGGGCTTCCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-1403s21c1
Sequence:CCGGTAGGCCAAACTACCAACTAAACTCGAGTTTAGTTGGTAGTTTGGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-2255s21c1
Sequence:CCGGGAGCATTCATGGTCCATTAAACTCGAGTTTAATGGACCATGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145197
SPATA31D4 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily D, member 4
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000418724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-2780s21c1
Sequence:CCAGGATGTTGGAAGCCCATATTAACTCGAGTTAATATGGGCTTCCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-1403s21c1
Sequence:CCGGTAGGCCAAACTACCAACTAAACTCGAGTTTAGTTGGTAGTTTGGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145197.1-2255s21c1
Sequence:CCGGGAGCATTCATGGTCCATTAAACTCGAGTTTAATGGACCATGAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks