EMAIL THIS PAGE TO A FRIEND

SPATA31E1

SPATA31 subfamily E, member 1

Synonyms: C9orf79 FAM75E1
Species: Human SPATA31E1(286234)
UniProtKB ID: Q6ZUB1, B2RPB1, Q5SQC9, Q8NA41, Q8ND27
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178828 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178828 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049339 predicted 2669
2 SASI_Hs01_00049340 predicted 2403
3 SASI_Hs01_00049341 predicted 2152
4 SASI_Hs01_00049342 predicted 2526
5 SASI_Hs02_00369874 predicted 2955
6 SASI_Hs02_00369875 predicted 2077
7 SASI_Hs02_00369876 predicted 4069
8 SASI_Hs01_00049344 predicted 4125
9 SASI_Hs01_00049345 predicted 2205
10 SASI_Hs01_00049346 predicted 3320
11 SASI_Hs01_00049343 predicted 390
12 SASI_Hs01_00049347 predicted 1931
13 SASI_Hs01_00049348 predicted 3807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178828
SPATA31E1 MISSION shRNA Bacterial Glycerol Stock
SPATA31 subfamily E, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-130s21c1
Sequence:CCGGAGTGCACAGGAGACGACATTGCTCGAGCAATGTCGTCTCCTGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-3325s21c1
Sequence:CCGGTCAGTGAGATTGCGCTCATAGCTCGAGCTATGAGCGCAATCTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-1227s21c1
Sequence:CCGCTGGGACATCACGACCCTAAATCTCGAGATTTAGGGTCGTGATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3494s1c1
Sequence:CCGGCCAGAGTGTGTCTGGTAAGAACTCGAGTTCTTACCAGACACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-2263s1c1
Sequence:CCGGCCTGGAAGTACCAATCAGTAACTCGAGTTACTGATTGGTACTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-2604s1c1
Sequence:CCGGCCCATAAATGTCTGGTCAGGTCTCGAGACCTGACCAGACATTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3825s1c1
Sequence:CCGGCAGAGAAAGATCAGTCACCATCTCGAGATGGTGACTGATCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3992s1c1
Sequence:CCGGCAGCAGAGTTGTGGGACAAATCTCGAGATTTGTCCCACAACTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178828
SPATA31E1 MISSION shRNA shRNA Plasmid DNA
SPATA31 subfamily E, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-130s21c1
Sequence:CCGGAGTGCACAGGAGACGACATTGCTCGAGCAATGTCGTCTCCTGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-3325s21c1
Sequence:CCGGTCAGTGAGATTGCGCTCATAGCTCGAGCTATGAGCGCAATCTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-1227s21c1
Sequence:CCGCTGGGACATCACGACCCTAAATCTCGAGATTTAGGGTCGTGATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3494s1c1
Sequence:CCGGCCAGAGTGTGTCTGGTAAGAACTCGAGTTCTTACCAGACACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-2263s1c1
Sequence:CCGGCCTGGAAGTACCAATCAGTAACTCGAGTTACTGATTGGTACTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-2604s1c1
Sequence:CCGGCCCATAAATGTCTGGTCAGGTCTCGAGACCTGACCAGACATTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3825s1c1
Sequence:CCGGCAGAGAAAGATCAGTCACCATCTCGAGATGGTGACTGATCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3992s1c1
Sequence:CCGGCAGCAGAGTTGTGGGACAAATCTCGAGATTTGTCCCACAACTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178828
SPATA31E1 MISSION shRNA Lentiviral Transduction Particles
SPATA31 subfamily E, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-130s21c1
Sequence:CCGGAGTGCACAGGAGACGACATTGCTCGAGCAATGTCGTCTCCTGTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-3325s21c1
Sequence:CCGGTCAGTGAGATTGCGCTCATAGCTCGAGCTATGAGCGCAATCTCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178828.4-1227s21c1
Sequence:CCGCTGGGACATCACGACCCTAAATCTCGAGATTTAGGGTCGTGATGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3494s1c1
Sequence:CCGGCCAGAGTGTGTCTGGTAAGAACTCGAGTTCTTACCAGACACACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-2263s1c1
Sequence:CCGGCCTGGAAGTACCAATCAGTAACTCGAGTTACTGATTGGTACTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-2604s1c1
Sequence:CCGGCCCATAAATGTCTGGTCAGGTCTCGAGACCTGACCAGACATTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3825s1c1
Sequence:CCGGCAGAGAAAGATCAGTCACCATCTCGAGATGGTGACTGATCTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178828.3-3992s1c1
Sequence:CCGGCAGCAGAGTTGTGGGACAAATCTCGAGATTTGTCCCACAACTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks