EMAIL THIS PAGE TO A FRIEND

SPATA32

spermatogenesis associated 32

Synonyms: AEP2 C17orf46 TEX34 VAD1.2
UniProtKB ID: Q96LK8, Q7Z4U1, Q8N6V6
Gene ID:
Mouse(328019) spermatogenesis associated 32
Rat(287747) spermatogenesis associated 32
domestic cat(101087283) spermatogenesis associated 32
domestic guinea pig(101788365) spermatogenesis associated 32
sheep(101119488) spermatogenesis associated 32
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152343 Rosetta Predictions human pricing
NM_001005531 Rosetta Predictions rat pricing
NM_177801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062552 predicted 794
2 SASI_Hs01_00062553 predicted 867
3 SASI_Hs02_00365962 predicted 494
4 SASI_Hs01_00062555 predicted 273
5 SASI_Hs01_00062556 predicted 1042
6 SASI_Hs01_00062557 predicted 1025
7 SASI_Hs01_00062558 predicted 460
8 SASI_Hs01_00062559 predicted 558
9 SASI_Hs01_00062560 predicted 486
10 SASI_Hs01_00062561 predicted 321
11 SASI_Hs01_00062554 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099289 predicted 280
2 SASI_Rn01_00099290 predicted 358
3 SASI_Rn01_00099291 predicted 707
4 SASI_Rn01_00099293 predicted 855
5 SASI_Rn01_00099294 predicted 684
6 SASI_Rn02_00198383 predicted 867
7 SASI_Rn01_00099295 predicted 286
8 SASI_Rn01_00099296 predicted 218
9 SASI_Rn01_00099297 predicted 570
10 SASI_Rn01_00099298 predicted 514
11 SASI_Rn01_00099292 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051459 predicted 724
2 SASI_Mm01_00051460 predicted 672
3 SASI_Mm01_00051461 predicted 404
4 SASI_Mm01_00051462 predicted 656
5 SASI_Mm01_00051463 predicted 782
6 SASI_Mm01_00051464 predicted 719
7 SASI_Mm01_00051465 predicted 542
8 SASI_Mm01_00051466 predicted 686
9 SASI_Mm01_00051467 predicted 788
10 SASI_Mm01_00051468 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177801
SPATA32 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 32
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.2-564s1c1
Sequence:CCGGCAGAATGTACCCAACCACCATCTCGAGATGGTGGTTGGGTACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.2-727s1c1
Sequence:CCGGGAAGTCCCAGAATACCTCTTTCTCGAGAAAGAGGTATTCTGGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-292s21c1
Sequence:CCGGGAGCCAGAATTACCCTCTAAACTCGAGTTTAGAGGGTAATTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-882s21c1
Sequence:CCGGTTGCTCTTACCTGGATATTAACTCGAGTTAATATCCAGGTAAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-680s21c1
Sequence:CCGGACATGGCCTTGCCTAACTTAGCTCGAGCTAAGTTAGGCAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-428s21c1
Sequence:CCGGTCCCTGTGCAGACCTCTAAACCTCGAGGTTTAGAGGTCTGCACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.3-881s1c1
Sequence:CCGGCTTGCTCTTACCTGGATATTACTCGAGTAATATCCAGGTAAGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-719s21c1
Sequence:CCGGCATCTGAGAAGTCCCAGAATACTCGAGTATTCTGGGACTTCTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177801
SPATA32 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 32
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.2-564s1c1
Sequence:CCGGCAGAATGTACCCAACCACCATCTCGAGATGGTGGTTGGGTACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.2-727s1c1
Sequence:CCGGGAAGTCCCAGAATACCTCTTTCTCGAGAAAGAGGTATTCTGGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-292s21c1
Sequence:CCGGGAGCCAGAATTACCCTCTAAACTCGAGTTTAGAGGGTAATTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-882s21c1
Sequence:CCGGTTGCTCTTACCTGGATATTAACTCGAGTTAATATCCAGGTAAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-680s21c1
Sequence:CCGGACATGGCCTTGCCTAACTTAGCTCGAGCTAAGTTAGGCAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-428s21c1
Sequence:CCGGTCCCTGTGCAGACCTCTAAACCTCGAGGTTTAGAGGTCTGCACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.3-881s1c1
Sequence:CCGGCTTGCTCTTACCTGGATATTACTCGAGTAATATCCAGGTAAGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-719s21c1
Sequence:CCGGCATCTGAGAAGTCCCAGAATACTCGAGTATTCTGGGACTTCTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177801
SPATA32 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 32
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.2-564s1c1
Sequence:CCGGCAGAATGTACCCAACCACCATCTCGAGATGGTGGTTGGGTACATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.2-727s1c1
Sequence:CCGGGAAGTCCCAGAATACCTCTTTCTCGAGAAAGAGGTATTCTGGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-292s21c1
Sequence:CCGGGAGCCAGAATTACCCTCTAAACTCGAGTTTAGAGGGTAATTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-882s21c1
Sequence:CCGGTTGCTCTTACCTGGATATTAACTCGAGTTAATATCCAGGTAAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-680s21c1
Sequence:CCGGACATGGCCTTGCCTAACTTAGCTCGAGCTAAGTTAGGCAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-428s21c1
Sequence:CCGGTCCCTGTGCAGACCTCTAAACCTCGAGGTTTAGAGGTCTGCACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177801.3-881s1c1
Sequence:CCGGCTTGCTCTTACCTGGATATTACTCGAGTAATATCCAGGTAAGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177801.3-719s21c1
Sequence:CCGGCATCTGAGAAGTCCCAGAATACTCGAGTATTCTGGGACTTCTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152343
SPATA32 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 32
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-307s1c1
Sequence:CCGGGCTTTACTGGAGTCAGAGCTACTCGAGTAGCTCTGACTCCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-567s1c1
Sequence:CCGGCTTCTGGGCAAACAAGCTCATCTCGAGATGAGCTTGTTTGCCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-379s1c1
Sequence:CCGGGAGGAGTCTGACTTTGAAGAACTCGAGTTCTTCAAAGTCAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-1047s1c1
Sequence:CCGGCGCTCAATCTTACTTTGACTTCTCGAGAAGTCAAAGTAAGATTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-1038s1c1
Sequence:CCGGCAAGAACTTCGCTCAATCTTACTCGAGTAAGATTGAGCGAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-812s1c1
Sequence:CCGGCAGAGCTAATCACCTTTGCATCTCGAGATGCAAAGGTGATTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-872s1c1
Sequence:CCGGCCAGTTTGGAACACATGATGACTCGAGTCATCATGTGTTCCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-880s1c1
Sequence:CCGGGAACACATGATGAAAGCTCCACTCGAGTGGAGCTTTCATCATGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152343.2-403s21c1
Sequence:CCGGATGCAGCTGGTATGCAAGATACTCGAGTATCTTGCATACCAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152343
SPATA32 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 32
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-307s1c1
Sequence:CCGGGCTTTACTGGAGTCAGAGCTACTCGAGTAGCTCTGACTCCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-567s1c1
Sequence:CCGGCTTCTGGGCAAACAAGCTCATCTCGAGATGAGCTTGTTTGCCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-379s1c1
Sequence:CCGGGAGGAGTCTGACTTTGAAGAACTCGAGTTCTTCAAAGTCAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-1047s1c1
Sequence:CCGGCGCTCAATCTTACTTTGACTTCTCGAGAAGTCAAAGTAAGATTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-1038s1c1
Sequence:CCGGCAAGAACTTCGCTCAATCTTACTCGAGTAAGATTGAGCGAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-812s1c1
Sequence:CCGGCAGAGCTAATCACCTTTGCATCTCGAGATGCAAAGGTGATTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-872s1c1
Sequence:CCGGCCAGTTTGGAACACATGATGACTCGAGTCATCATGTGTTCCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-880s1c1
Sequence:CCGGGAACACATGATGAAAGCTCCACTCGAGTGGAGCTTTCATCATGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152343.2-403s21c1
Sequence:CCGGATGCAGCTGGTATGCAAGATACTCGAGTATCTTGCATACCAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152343
SPATA32 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 32
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-307s1c1
Sequence:CCGGGCTTTACTGGAGTCAGAGCTACTCGAGTAGCTCTGACTCCAGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-567s1c1
Sequence:CCGGCTTCTGGGCAAACAAGCTCATCTCGAGATGAGCTTGTTTGCCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-379s1c1
Sequence:CCGGGAGGAGTCTGACTTTGAAGAACTCGAGTTCTTCAAAGTCAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-1047s1c1
Sequence:CCGGCGCTCAATCTTACTTTGACTTCTCGAGAAGTCAAAGTAAGATTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-1038s1c1
Sequence:CCGGCAAGAACTTCGCTCAATCTTACTCGAGTAAGATTGAGCGAAGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-812s1c1
Sequence:CCGGCAGAGCTAATCACCTTTGCATCTCGAGATGCAAAGGTGATTAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152343.1-872s1c1
Sequence:CCGGCCAGTTTGGAACACATGATGACTCGAGTCATCATGTGTTCCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152343.1-880s1c1
Sequence:CCGGGAACACATGATGAAAGCTCCACTCGAGTGGAGCTTTCATCATGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152343.2-403s21c1
Sequence:CCGGATGCAGCTGGTATGCAAGATACTCGAGTATCTTGCATACCAGCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks