EMAIL THIS PAGE TO A FRIEND

SPATA33

spermatogenesis associated 33

Synonyms: C16orf55
Gene ID:
Mouse(320869) spermatogenesis associated 33
cow(100848931) spermatogenesis associated 33
dog(100683411) spermatogenesis associated 33
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153025 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153025 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153025 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153025 Rosetta Predictions human pricing
NM_177279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059416 predicted 207
2 SASI_Hs01_00059417 predicted 387
3 SASI_Hs01_00059418 predicted 372
4 SASI_Hs02_00366980 predicted 1737
5 SASI_Hs01_00059419 predicted 1551
6 SASI_Hs01_00059420 predicted 1747
7 SASI_Hs02_00366981 predicted 1332
8 SASI_Hs01_00059421 predicted 1537
9 SASI_Hs01_00059422 predicted 1809
10 SASI_Hs02_00366982 predicted 1743
11 SASI_Hs01_00059423 predicted 1926
12 SASI_Hs01_00059424 predicted 2079
13 SASI_Hs01_00059425 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347337 predicted 265
2 SASI_Mm02_00347338 predicted 264
3 SASI_Mm02_00347339 predicted 233
4 SASI_Mm02_00347340 predicted 221
5 SASI_Mm02_00347341 predicted 267
6 SASI_Mm02_00347342 predicted 293
7 SASI_Mm02_00347343 predicted 292
8 SASI_Mm02_00347344 predicted 271
9 SASI_Mm02_00347345 predicted 213
10 SASI_Mm02_00347346 predicted 235
11 SASI_Mm01_00175099 predicted 704
12 SASI_Mm01_00175100 predicted 621
13 SASI_Mm01_00175101 predicted 1068
14 SASI_Mm01_00175102 predicted 885
15 SASI_Mm01_00175103 predicted 1097
16 SASI_Mm01_00175104 predicted 917
17 SASI_Mm01_00175105 predicted 1074
18 SASI_Mm01_00175106 predicted 564
19 SASI_Mm01_00175107 predicted 464
20 SASI_Mm01_00175108 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177279
SPATA33 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177279.4-330s21c1
Sequence:CCGGGTGTCATCCCGCAGATCATCACTCGAGTGATGATCTGCGGGATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-683s1c1
Sequence:CCGGCCACAGTGATCCCTTCAACATCTCGAGATGTTGAAGGGATCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-562s1c1
Sequence:CCGGGATTTCAAGGGCATCTTGTATCTCGAGATACAAGATGCCCTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-623s1c1
Sequence:CCGGCGAAACTTGAGCGATCCATAACTCGAGTTATGGATCGCTCAAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177279.2-2525s1c1
Sequence:CCGGGCACCAGATATGCACATGATACTCGAGTATCATGTGCATATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177279
SPATA33 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177279.4-330s21c1
Sequence:CCGGGTGTCATCCCGCAGATCATCACTCGAGTGATGATCTGCGGGATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-683s1c1
Sequence:CCGGCCACAGTGATCCCTTCAACATCTCGAGATGTTGAAGGGATCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-562s1c1
Sequence:CCGGGATTTCAAGGGCATCTTGTATCTCGAGATACAAGATGCCCTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-623s1c1
Sequence:CCGGCGAAACTTGAGCGATCCATAACTCGAGTTATGGATCGCTCAAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177279.2-2525s1c1
Sequence:CCGGGCACCAGATATGCACATGATACTCGAGTATCATGTGCATATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177279
SPATA33 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177279.4-330s21c1
Sequence:CCGGGTGTCATCCCGCAGATCATCACTCGAGTGATGATCTGCGGGATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-683s1c1
Sequence:CCGGCCACAGTGATCCCTTCAACATCTCGAGATGTTGAAGGGATCACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-562s1c1
Sequence:CCGGGATTTCAAGGGCATCTTGTATCTCGAGATACAAGATGCCCTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177279.2-623s1c1
Sequence:CCGGCGAAACTTGAGCGATCCATAACTCGAGTTATGGATCGCTCAAGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177279.2-2525s1c1
Sequence:CCGGGCACCAGATATGCACATGATACTCGAGTATCATGTGCATATCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153025
SPATA33 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 33
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153025.1-382s21c1
Sequence:CCGGAGTACAGCAGACGCCTATAATCTCGAGATTATAGGCGTCTGCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153025.1-265s21c1
Sequence:CCGGATCATCACGCGAGCGTCGAATCTCGAGATTCGACGCTCGCGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-281s1c1
Sequence:CCGGCGAATGAGACGCTAGTCAGTTCTCGAGAACTGACTAGCGTCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-240s1c1
Sequence:CCGGGAAGAAAGTGGTCGTTCCACACTCGAGTGTGGAACGACCACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153025.1-87s1c1
Sequence:CCGGGTTGATGGAGAAGCATTCCCACTCGAGTGGGAATGCTTCTCCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-208s1c1
Sequence:CCGGGAGAAACCTGATGTAAAGCAACTCGAGTTGCTTTACATCAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153025.1-1331s1c1
Sequence:CCGGGCGAGCTTTGTGGTATTGATACTCGAGTATCAATACCACAAAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-48s1c1
Sequence:CCGGGAAGGGATCCACCTATTCAGTCTCGAGACTGAATAGGTGGATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153025
SPATA33 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 33
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153025.1-382s21c1
Sequence:CCGGAGTACAGCAGACGCCTATAATCTCGAGATTATAGGCGTCTGCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153025.1-265s21c1
Sequence:CCGGATCATCACGCGAGCGTCGAATCTCGAGATTCGACGCTCGCGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-281s1c1
Sequence:CCGGCGAATGAGACGCTAGTCAGTTCTCGAGAACTGACTAGCGTCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-240s1c1
Sequence:CCGGGAAGAAAGTGGTCGTTCCACACTCGAGTGTGGAACGACCACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153025.1-87s1c1
Sequence:CCGGGTTGATGGAGAAGCATTCCCACTCGAGTGGGAATGCTTCTCCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-208s1c1
Sequence:CCGGGAGAAACCTGATGTAAAGCAACTCGAGTTGCTTTACATCAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153025.1-1331s1c1
Sequence:CCGGGCGAGCTTTGTGGTATTGATACTCGAGTATCAATACCACAAAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-48s1c1
Sequence:CCGGGAAGGGATCCACCTATTCAGTCTCGAGACTGAATAGGTGGATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153025
SPATA33 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 33
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153025.1-382s21c1
Sequence:CCGGAGTACAGCAGACGCCTATAATCTCGAGATTATAGGCGTCTGCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153025.1-265s21c1
Sequence:CCGGATCATCACGCGAGCGTCGAATCTCGAGATTCGACGCTCGCGTGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-281s1c1
Sequence:CCGGCGAATGAGACGCTAGTCAGTTCTCGAGAACTGACTAGCGTCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-240s1c1
Sequence:CCGGGAAGAAAGTGGTCGTTCCACACTCGAGTGTGGAACGACCACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153025.1-87s1c1
Sequence:CCGGGTTGATGGAGAAGCATTCCCACTCGAGTGGGAATGCTTCTCCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-208s1c1
Sequence:CCGGGAGAAACCTGATGTAAAGCAACTCGAGTTGCTTTACATCAGGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153025.1-1331s1c1
Sequence:CCGGGCGAGCTTTGTGGTATTGATACTCGAGTATCAATACCACAAAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153025.1-48s1c1
Sequence:CCGGGAAGGGATCCACCTATTCAGTCTCGAGACTGAATAGGTGGATCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks