EMAIL THIS PAGE TO A FRIEND

SPATA3

spermatogenesis associated 3

Synonyms: TSARG1
UniProtKB ID: Q8NHX4, Q86WX5, Q8N9Y6
Gene ID:
Mouse(70060) spermatogenesis associated 3
Rat(363270) spermatogenesis associated 3
domestic cat(101094442) spermatogenesis associated 3
dog(477404) spermatogenesis associated 3
domestic guinea pig(100726577) spermatogenesis associated 3
naked mole-rat(101698353) spermatogenesis associated 3
cow(617853) spermatogenesis associated 3
sheep(101106570) spermatogenesis associated 3
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027029 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027029 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027029 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139073 Rosetta Predictions human pricing
XR_015911 Rosetta Predictions human pricing
XR_040698 Rosetta Predictions human pricing
NM_001108805 Rosetta Predictions rat pricing
NM_001122732 Rosetta Predictions mouse pricing
NM_027029 Rosetta Predictions mouse pricing
NM_027300 Rosetta Predictions mouse pricing
NM_028647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067425 predicted 666
2 SASI_Hs01_00067426 predicted 674
3 SASI_Hs01_00067427 predicted 220
4 SASI_Hs01_00067428 predicted 493
5 SASI_Hs01_00067429 predicted 398
6 SASI_Hs01_00067430 predicted 252
7 SASI_Hs01_00067431 predicted 226
8 SASI_Hs01_00067432 predicted 425
9 SASI_Hs01_00067433 predicted 603
10 SASI_Hs01_00067434 predicted 617
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00489548 predicted 467
2 SASI_Hs02_00489549 predicted 463
3 SASI_Hs02_00489550 predicted 221
4 SASI_Hs02_00489551 predicted 370
5 SASI_Hs02_00489552 predicted 220
6 SASI_Hs02_00489553 predicted 290
7 SASI_Hs02_00489554 predicted 530
8 SASI_Hs02_00489555 predicted 399
9 SASI_Hs02_00489556 predicted 566
10 SASI_Hs02_00489557 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521108 predicted 216
2 SASI_Hs02_00521109 predicted 246
3 SASI_Hs02_00521110 predicted 193
4 SASI_Hs02_00521111 predicted 391
5 SASI_Hs02_00521112 predicted 244
6 SASI_Hs02_00521113 predicted 311
7 SASI_Hs02_00521114 predicted 212
8 SASI_Hs02_00521115 predicted 421
9 SASI_Hs02_00521116 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242245 predicted 391
2 SASI_Rn02_00242246 predicted 560
3 SASI_Rn02_00242247 predicted 937
4 SASI_Rn02_00242248 predicted 997
5 SASI_Rn02_00242249 predicted 1060
6 SASI_Rn02_00242250 predicted 785
7 SASI_Rn02_00242251 predicted 482
8 SASI_Rn02_00242252 predicted 799
9 SASI_Rn02_00242253 predicted 946
10 SASI_Rn02_00242254 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309264 predicted 680
2 SASI_Mm02_00309265 predicted 832
3 SASI_Mm02_00309266 predicted 668
4 SASI_Mm02_00309267 predicted 672
5 SASI_Mm02_00309268 predicted 615
6 SASI_Mm02_00309269 predicted 831
7 SASI_Mm02_00309270 predicted 871
8 SASI_Mm02_00309271 predicted 761
9 SASI_Mm02_00309272 predicted 756
10 SASI_Mm02_00309273 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027029 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331424 predicted 281
2 SASI_Mm01_00174849 predicted 363
3 SASI_Mm02_00331425 predicted 271
4 SASI_Mm01_00174850 predicted 368
5 SASI_Mm01_00174851 predicted 496
6 SASI_Mm01_00174852 predicted 289
7 SASI_Mm01_00174853 predicted 287
8 SASI_Mm01_00174854 predicted 276
9 SASI_Mm01_00174855 predicted 359
10 SASI_Mm01_00174856 predicted 380
11 SASI_Mm01_00174857 predicted 382
12 SASI_Mm01_00174858 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331908 predicted 676
2 SASI_Mm01_00052532 predicted 832
3 SASI_Mm02_00331909 predicted 671
4 SASI_Mm02_00331910 predicted 676
5 SASI_Mm01_00052535 predicted 614
6 SASI_Mm01_00052536 predicted 832
7 SASI_Mm02_00331911 predicted 874
8 SASI_Mm02_00331912 predicted 758
9 SASI_Mm01_00052538 predicted 760
10 SASI_Mm02_00331913 predicted 762
11 SASI_Mm01_00052529 predicted 365
12 SASI_Mm01_00052530 predicted 282
13 SASI_Mm01_00052531 predicted 544
14 SASI_Mm01_00052533 predicted 268
15 SASI_Mm01_00052534 predicted 354
16 SASI_Mm01_00052537 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334159 predicted 287
2 SASI_Mm02_00334160 predicted 281
3 SASI_Mm02_00334161 predicted 275
4 SASI_Mm01_00128219 predicted 292
5 SASI_Mm02_00334162 predicted 287
6 SASI_Mm02_00334163 predicted 271
7 SASI_Mm02_00334164 predicted 219
8 SASI_Mm02_00334165 predicted 217
9 SASI_Mm02_00334166 predicted 316
10 SASI_Mm02_00334167 predicted 262
11 SASI_Mm01_00128218 predicted 372
12 SASI_Mm01_00128220 predicted 551
13 SASI_Mm01_00128221 predicted 360
14 SASI_Mm01_00128222 predicted 614
15 SASI_Mm01_00128223 predicted 554
16 SASI_Mm01_00128224 predicted 805
17 SASI_Mm01_00128225 predicted 745
18 SASI_Mm01_00128226 predicted 737
19 SASI_Mm01_00128227 predicted 730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139073
SPATA3 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1256s1c1
Sequence:CCGGCCCTCAATATCCTCCTCAGATCTCGAGATCTGAGGAGGATATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1083s1c1
Sequence:CCGGGCCAAACTTGCTGGGTTACATCTCGAGATGTAACCCAGCAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1257s1c1
Sequence:CCGGCCTCAATATCCTCCTCAGATTCTCGAGAATCTGAGGAGGATATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1061s1c1
Sequence:CCGGCCTCGAATAAAGGCCAGATAACTCGAGTTATCTGGCCTTTATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1218s1c1
Sequence:CCGGGCATCCTTCATTTGAGAATAACTCGAGTTATTCTCAAATGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1309s1c1
Sequence:CCGGCCTAAGAACAAGCCATCTGATCTCGAGATCAGATGGCTTGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-491s21c1
Sequence:CCGGGCTATGCCATAGCCGCATCTTCTCGAGAAGATGCGGCTATGGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-606s21c1
Sequence:CCGGAGTCATCGTAACGCGTGTCCTCTCGAGAGGACACGCGTTACGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-169s21c1
Sequence:CCGGAGCATGCTAGCTCCAATTCCACTCGAGTGGAATTGGAGCTAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139073
SPATA3 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1256s1c1
Sequence:CCGGCCCTCAATATCCTCCTCAGATCTCGAGATCTGAGGAGGATATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1083s1c1
Sequence:CCGGGCCAAACTTGCTGGGTTACATCTCGAGATGTAACCCAGCAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1257s1c1
Sequence:CCGGCCTCAATATCCTCCTCAGATTCTCGAGAATCTGAGGAGGATATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1061s1c1
Sequence:CCGGCCTCGAATAAAGGCCAGATAACTCGAGTTATCTGGCCTTTATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1218s1c1
Sequence:CCGGGCATCCTTCATTTGAGAATAACTCGAGTTATTCTCAAATGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1309s1c1
Sequence:CCGGCCTAAGAACAAGCCATCTGATCTCGAGATCAGATGGCTTGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-491s21c1
Sequence:CCGGGCTATGCCATAGCCGCATCTTCTCGAGAAGATGCGGCTATGGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-606s21c1
Sequence:CCGGAGTCATCGTAACGCGTGTCCTCTCGAGAGGACACGCGTTACGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-169s21c1
Sequence:CCGGAGCATGCTAGCTCCAATTCCACTCGAGTGGAATTGGAGCTAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139073
SPATA3 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172995    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1256s1c1
Sequence:CCGGCCCTCAATATCCTCCTCAGATCTCGAGATCTGAGGAGGATATTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172692    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1083s1c1
Sequence:CCGGGCCAAACTTGCTGGGTTACATCTCGAGATGTAACCCAGCAAGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168240    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1257s1c1
Sequence:CCGGCCTCAATATCCTCCTCAGATTCTCGAGAATCTGAGGAGGATATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1061s1c1
Sequence:CCGGCCTCGAATAAAGGCCAGATAACTCGAGTTATCTGGCCTTTATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167456    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1218s1c1
Sequence:CCGGGCATCCTTCATTTGAGAATAACTCGAGTTATTCTCAAATGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168082    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_139073.2-1309s1c1
Sequence:CCGGCCTAAGAACAAGCCATCTGATCTCGAGATCAGATGGCTTGTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-491s21c1
Sequence:CCGGGCTATGCCATAGCCGCATCTTCTCGAGAAGATGCGGCTATGGCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-606s21c1
Sequence:CCGGAGTCATCGTAACGCGTGTCCTCTCGAGAGGACACGCGTTACGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139073.3-169s21c1
Sequence:CCGGAGCATGCTAGCTCCAATTCCACTCGAGTGGAATTGGAGCTAGCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027029
SPATA3 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027029.1-499s1c1
Sequence:CCGGCCGAATCTTTGATGTCCTCCTCTCGAGAGGAGGACATCAAAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-298s21c1
Sequence:CCGGCTAAACCGCAACAGCATACACCTCGAGGTGTATGCTGTTGCGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-154s21c1
Sequence:CCGGATTCCATTTCACCGCAGACTACTCGAGTAGTCTGCGGTGAAATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-488s21c1
Sequence:CCGGGCTTTGCCATAGCCGAATCTTCTCGAGAAGATTCGGCTATGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-270s21c1
Sequence:CCGGACCACACCACACCAAGTTAACCTCGAGGTTAACTTGGTGTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-372s21c1
Sequence:CCGGATGGAACCTAAACCAATTCTTCTCGAGAAGAATTGGTTTAGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027029
SPATA3 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027029.1-499s1c1
Sequence:CCGGCCGAATCTTTGATGTCCTCCTCTCGAGAGGAGGACATCAAAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-298s21c1
Sequence:CCGGCTAAACCGCAACAGCATACACCTCGAGGTGTATGCTGTTGCGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-154s21c1
Sequence:CCGGATTCCATTTCACCGCAGACTACTCGAGTAGTCTGCGGTGAAATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-488s21c1
Sequence:CCGGGCTTTGCCATAGCCGAATCTTCTCGAGAAGATTCGGCTATGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-270s21c1
Sequence:CCGGACCACACCACACCAAGTTAACCTCGAGGTTAACTTGGTGTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-372s21c1
Sequence:CCGGATGGAACCTAAACCAATTCTTCTCGAGAAGAATTGGTTTAGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027029
SPATA3 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027029.1-499s1c1
Sequence:CCGGCCGAATCTTTGATGTCCTCCTCTCGAGAGGAGGACATCAAAGATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-298s21c1
Sequence:CCGGCTAAACCGCAACAGCATACACCTCGAGGTGTATGCTGTTGCGGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-154s21c1
Sequence:CCGGATTCCATTTCACCGCAGACTACTCGAGTAGTCTGCGGTGAAATGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-488s21c1
Sequence:CCGGGCTTTGCCATAGCCGAATCTTCTCGAGAAGATTCGGCTATGGCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-270s21c1
Sequence:CCGGACCACACCACACCAAGTTAACCTCGAGGTTAACTTGGTGTGGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027029.2-372s21c1
Sequence:CCGGATGGAACCTAAACCAATTCTTCTCGAGAAGAATTGGTTTAGGTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks