EMAIL THIS PAGE TO A FRIEND

SPATA41

spermatogenesis associated 41 (non-protein coding)

Species: Human SPATA41(388182)
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_370911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370911 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207383 Rosetta Predictions human pricing
XR_041191 Rosetta Predictions human pricing
XR_041192 Rosetta Predictions human pricing
XR_041193 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046965 predicted 229
2 SASI_Hs01_00046966 predicted 1118
3 SASI_Hs01_00046967 predicted 1195
4 SASI_Hs01_00046968 predicted 1281
5 SASI_Hs01_00046969 predicted 1286
6 SASI_Hs01_00046970 predicted 1168
7 SASI_Hs01_00046971 predicted 1288
8 SASI_Hs01_00046972 predicted 1509
9 SASI_Hs01_00046973 predicted 1204
10 SASI_Hs01_00046974 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525402 predicted 1482
2 SASI_Hs02_00525403 predicted 714
3 SASI_Hs02_00525404 predicted 453
4 SASI_Hs02_00525405 predicted 1418
5 SASI_Hs02_00525406 predicted 1015
6 SASI_Hs02_00525407 predicted 1445
7 SASI_Hs02_00525408 predicted 1058
8 SASI_Hs02_00525409 predicted 1148
9 SASI_Hs02_00525410 predicted 1171
10 SASI_Hs02_00525411 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525412 predicted 1483
2 SASI_Hs02_00525413 predicted 712
3 SASI_Hs02_00525414 predicted 452
4 SASI_Hs02_00525415 predicted 1425
5 SASI_Hs02_00525416 predicted 1019
6 SASI_Hs02_00525417 predicted 1446
7 SASI_Hs02_00525418 predicted 1056
8 SASI_Hs02_00525419 predicted 1148
9 SASI_Hs02_00525420 predicted 1167
10 SASI_Hs02_00525421 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525422 predicted 860
2 SASI_Hs02_00525423 predicted 509
3 SASI_Hs02_00525424 predicted 465
4 SASI_Hs02_00525425 predicted 494
5 SASI_Hs02_00525426 predicted 592
6 SASI_Hs02_00525427 predicted 719
7 SASI_Hs02_00525428 predicted 609
8 SASI_Hs02_00525429 predicted 306
9 SASI_Hs02_00525430 predicted 714
10 SASI_Hs02_00525431 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370911
SPATA41 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 41 (non-protein coding)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1458s1c1
Sequence:CCGGGCTTTGTCTATCTCAAGGGTACTCGAGTACCCTTGAGATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1290s1c1
Sequence:CCGGCAATTATCACAGTGACGGTGACTCGAGTCACCGTCACTGTGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1284s1c1
Sequence:CCGGCGACAACAATTATCACAGTGACTCGAGTCACTGTGATAATTGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-785s1c1
Sequence:CCGGCTCAACAGGAAAGTAGTGAAACTCGAGTTTCACTACTTTCCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370911.1-1553s1c1
Sequence:CCGGCTCAGAAAGACACTGCCTGTACTCGAGTACAGGCAGTGTCTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370911
SPATA41 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 41 (non-protein coding)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1458s1c1
Sequence:CCGGGCTTTGTCTATCTCAAGGGTACTCGAGTACCCTTGAGATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1290s1c1
Sequence:CCGGCAATTATCACAGTGACGGTGACTCGAGTCACCGTCACTGTGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1284s1c1
Sequence:CCGGCGACAACAATTATCACAGTGACTCGAGTCACTGTGATAATTGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-785s1c1
Sequence:CCGGCTCAACAGGAAAGTAGTGAAACTCGAGTTTCACTACTTTCCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370911.1-1553s1c1
Sequence:CCGGCTCAGAAAGACACTGCCTGTACTCGAGTACAGGCAGTGTCTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370911
SPATA41 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 41 (non-protein coding)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1458s1c1
Sequence:CCGGGCTTTGTCTATCTCAAGGGTACTCGAGTACCCTTGAGATAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1290s1c1
Sequence:CCGGCAATTATCACAGTGACGGTGACTCGAGTCACCGTCACTGTGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-1284s1c1
Sequence:CCGGCGACAACAATTATCACAGTGACTCGAGTCACTGTGATAATTGTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370911.1-785s1c1
Sequence:CCGGCTCAACAGGAAAGTAGTGAAACTCGAGTTTCACTACTTTCCTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_370911.1-1553s1c1
Sequence:CCGGCTCAGAAAGACACTGCCTGTACTCGAGTACAGGCAGTGTCTTTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks