EMAIL THIS PAGE TO A FRIEND

SPATA4

spermatogenesis associated 4

Synonyms: SPEF1B TSARG2
UniProtKB ID: Q8NEY3, Q8NCS5, Q8WW15
Gene ID:
Mouse(69281) spermatogenesis associated 4
Rat(306441) spermatogenesis associated 4
Zebrafish(445563) spermatogenesis associated 4
domestic cat(101084870) spermatogenesis associated 4
dog(609025) spermatogenesis associated 4
chicken(422571) spermatogenesis associated 4
cow(497023) spermatogenesis associated 4
sheep(101107763) spermatogenesis associated 4
domestic guinea pig(100725467) spermatogenesis associated 4
naked mole-rat(101708555) spermatogenesis associated 4
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144644 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039051 MISSION® esiRNA esiRNA human SPATA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144644 Rosetta Predictions human pricing
NM_001002852 Rosetta Predictions rat pricing
NM_133711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085744 predicted 814
2 SASI_Hs01_00085745 predicted 790
3 SASI_Hs01_00085746 predicted 651
4 SASI_Hs01_00085748 predicted 720
5 SASI_Hs02_00364498 predicted 662
6 SASI_Hs01_00085750 predicted 920
7 SASI_Hs01_00085751 predicted 819
8 SASI_Hs02_00364499 predicted 596
9 SASI_Hs02_00364500 predicted 957
10 SASI_Hs02_00364501 predicted 965
11 SASI_Hs01_00085743 predicted 987
12 SASI_Hs01_00085747 predicted 956
13 SASI_Hs01_00085749 predicted 985
14 SASI_Hs01_00085752 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198025 predicted 647
2 SASI_Rn01_00076235 predicted 718
3 SASI_Rn01_00076236 predicted 605
4 SASI_Rn01_00076237 predicted 625
5 SASI_Rn01_00076238 predicted 751
6 SASI_Rn01_00076240 predicted 716
7 SASI_Rn02_00198026 predicted 729
8 SASI_Rn01_00076241 predicted 826
9 SASI_Rn01_00076242 predicted 785
10 SASI_Rn01_00076243 predicted 613
11 SASI_Rn01_00076239 predicted 785
12 SASI_Rn01_00076244 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122393 predicted 510
2 SASI_Mm01_00122394 predicted 593
3 SASI_Mm01_00122395 predicted 550
4 SASI_Mm01_00122396 predicted 799
5 SASI_Mm01_00122397 predicted 456
6 SASI_Mm01_00122398 predicted 628
7 SASI_Mm01_00122399 predicted 444
8 SASI_Mm01_00122400 predicted 791
9 SASI_Mm01_00122401 predicted 589
10 SASI_Mm01_00122402 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133711
SPATA4 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133711.2-926s1c1
Sequence:CCGGGTGAAGGACATGGAGGAAGTACTCGAGTACTTCCTCCATGTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-774s1c1
Sequence:CCGGCGCAGATACAAGTCAAGAGGTCTCGAGACCTCTTGACTTGTATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-407s1c1
Sequence:CCGGCCATGGAACAATTCACTGTAACTCGAGTTACAGTGAATTGTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-250s1c1
Sequence:CCGGGCTACCTAGTTGCAGAGATATCTCGAGATATCTCTGCAACTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-761s1c1
Sequence:CCGGCCATAGCTATAAGCGCAGATACTCGAGTATCTGCGCTTATAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-291s1c1
Sequence:CCGGGACCTTCGATTATCATCCTTTCTCGAGAAAGGATGATAATCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-477s1c1
Sequence:CCGGCATCAAGAAATTAGAAGTATCCTCGAGGATACTTCTAATTTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-455s1c1
Sequence:CCGGGGAGATTTACACTTTACTAACCTCGAGGTTAGTAAAGTGTAAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-603s1c1
Sequence:CCGGGAACTACTAAGCAATCCTAATCTCGAGATTAGGATTGCTTAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133711
SPATA4 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133711.2-926s1c1
Sequence:CCGGGTGAAGGACATGGAGGAAGTACTCGAGTACTTCCTCCATGTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-774s1c1
Sequence:CCGGCGCAGATACAAGTCAAGAGGTCTCGAGACCTCTTGACTTGTATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-407s1c1
Sequence:CCGGCCATGGAACAATTCACTGTAACTCGAGTTACAGTGAATTGTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-250s1c1
Sequence:CCGGGCTACCTAGTTGCAGAGATATCTCGAGATATCTCTGCAACTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-761s1c1
Sequence:CCGGCCATAGCTATAAGCGCAGATACTCGAGTATCTGCGCTTATAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-291s1c1
Sequence:CCGGGACCTTCGATTATCATCCTTTCTCGAGAAAGGATGATAATCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-477s1c1
Sequence:CCGGCATCAAGAAATTAGAAGTATCCTCGAGGATACTTCTAATTTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-455s1c1
Sequence:CCGGGGAGATTTACACTTTACTAACCTCGAGGTTAGTAAAGTGTAAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-603s1c1
Sequence:CCGGGAACTACTAAGCAATCCTAATCTCGAGATTAGGATTGCTTAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133711
SPATA4 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133711.2-926s1c1
Sequence:CCGGGTGAAGGACATGGAGGAAGTACTCGAGTACTTCCTCCATGTCCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-774s1c1
Sequence:CCGGCGCAGATACAAGTCAAGAGGTCTCGAGACCTCTTGACTTGTATCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-407s1c1
Sequence:CCGGCCATGGAACAATTCACTGTAACTCGAGTTACAGTGAATTGTTCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-250s1c1
Sequence:CCGGGCTACCTAGTTGCAGAGATATCTCGAGATATCTCTGCAACTAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-761s1c1
Sequence:CCGGCCATAGCTATAAGCGCAGATACTCGAGTATCTGCGCTTATAGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133711.2-291s1c1
Sequence:CCGGGACCTTCGATTATCATCCTTTCTCGAGAAAGGATGATAATCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-477s1c1
Sequence:CCGGCATCAAGAAATTAGAAGTATCCTCGAGGATACTTCTAATTTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-455s1c1
Sequence:CCGGGGAGATTTACACTTTACTAACCTCGAGGTTAGTAAAGTGTAAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133711.3-603s1c1
Sequence:CCGGGAACTACTAAGCAATCCTAATCTCGAGATTAGGATTGCTTAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144644
SPATA4 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-956s1c1
Sequence:CCGGGTGAAGCAAGCTGGACAACATCTCGAGATGTTGTCCAGCTTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-598s1c1
Sequence:CCGGCTTTGTGAATTTCACGGACTACTCGAGTAGTCCGTGAAATTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-724s1c1
Sequence:CCGGCAATGAACTTAAAGCGGAGTTCTCGAGAACTCCGCTTTAAGTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144644.2-1063s1c1
Sequence:CCGGCACCATCTCTAGCCATAATAACTCGAGTTATTATGGCTAGAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-962s1c1
Sequence:CCGGCAAGCTGGACAACATTCTTATCTCGAGATAAGAATGTTGTCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-794s1c1
Sequence:CCGGCCAGAATGGTTTGATGTGAAACTCGAGTTTCACATCAAACCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-312s1c1
Sequence:CCGGCCAGGAACATCAACAGAGATTCTCGAGAATCTCTGTTGATGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-214s1c1
Sequence:CCGGGCCTAAGAAGTGTCTGGTCTACTCGAGTAGACCAGACACTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144644.2-1032s1c1
Sequence:CCGGCACCTGTCAAATGGCTTTGAACTCGAGTTCAAAGCCATTTGACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144644
SPATA4 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-956s1c1
Sequence:CCGGGTGAAGCAAGCTGGACAACATCTCGAGATGTTGTCCAGCTTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-598s1c1
Sequence:CCGGCTTTGTGAATTTCACGGACTACTCGAGTAGTCCGTGAAATTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-724s1c1
Sequence:CCGGCAATGAACTTAAAGCGGAGTTCTCGAGAACTCCGCTTTAAGTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144644.2-1063s1c1
Sequence:CCGGCACCATCTCTAGCCATAATAACTCGAGTTATTATGGCTAGAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-962s1c1
Sequence:CCGGCAAGCTGGACAACATTCTTATCTCGAGATAAGAATGTTGTCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-794s1c1
Sequence:CCGGCCAGAATGGTTTGATGTGAAACTCGAGTTTCACATCAAACCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-312s1c1
Sequence:CCGGCCAGGAACATCAACAGAGATTCTCGAGAATCTCTGTTGATGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-214s1c1
Sequence:CCGGGCCTAAGAAGTGTCTGGTCTACTCGAGTAGACCAGACACTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144644.2-1032s1c1
Sequence:CCGGCACCTGTCAAATGGCTTTGAACTCGAGTTCAAAGCCATTTGACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144644
SPATA4 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-956s1c1
Sequence:CCGGGTGAAGCAAGCTGGACAACATCTCGAGATGTTGTCCAGCTTGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-598s1c1
Sequence:CCGGCTTTGTGAATTTCACGGACTACTCGAGTAGTCCGTGAAATTCACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-724s1c1
Sequence:CCGGCAATGAACTTAAAGCGGAGTTCTCGAGAACTCCGCTTTAAGTTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144644.2-1063s1c1
Sequence:CCGGCACCATCTCTAGCCATAATAACTCGAGTTATTATGGCTAGAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-962s1c1
Sequence:CCGGCAAGCTGGACAACATTCTTATCTCGAGATAAGAATGTTGTCCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144644.2-794s1c1
Sequence:CCGGCCAGAATGGTTTGATGTGAAACTCGAGTTTCACATCAAACCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-312s1c1
Sequence:CCGGCCAGGAACATCAACAGAGATTCTCGAGAATCTCTGTTGATGTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144644.2-214s1c1
Sequence:CCGGGCCTAAGAAGTGTCTGGTCTACTCGAGTAGACCAGACACTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144644.2-1032s1c1
Sequence:CCGGCACCTGTCAAATGGCTTTGAACTCGAGTTCAAAGCCATTTGACAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks