EMAIL THIS PAGE TO A FRIEND

SPATA5

spermatogenesis associated 5

Synonyms: AFG2 SPAF
UniProtKB ID: Q8NB90, C9JT97, Q86XW1, Q8NI20, Q8TDL7
Gene ID:
Mouse(57815) spermatogenesis associated 5
Rat(361935) spermatogenesis associated 5
chicken(422665) spermatogenesis associated 5
dog(483840) spermatogenesis associated 5
Horse(100063769) spermatogenesis associated 5
domestic cat(101086718) spermatogenesis associated 5
naked mole-rat(101723993) spermatogenesis associated 5
domestic guinea pig(100732878) spermatogenesis associated 5
cow(100297992) spermatogenesis associated 5
sheep(101102425) spermatogenesis associated 5
cow(782646) spermatogenesis associated 5-like
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145207 Rosetta Predictions human pricing
NM_001108549 Rosetta Predictions rat pricing
NM_021343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125494 predicted 759
2 SASI_Hs01_00125495 predicted 1923
3 SASI_Hs01_00125496 predicted 1724
4 SASI_Hs01_00125498 predicted 628
5 SASI_Hs01_00125499 predicted 326
6 SASI_Hs01_00125500 predicted 2342
7 SASI_Hs01_00125501 predicted 591
8 SASI_Hs01_00125502 predicted 2355
9 SASI_Hs01_00125503 predicted 2294
10 SASI_Hs02_00365057 predicted 1015
11 SASI_Hs01_00125497 predicted 2120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108549 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239739 predicted 2446
2 SASI_Rn02_00239740 predicted 1908
3 SASI_Rn02_00239741 predicted 2368
4 SASI_Rn02_00239742 predicted 2799
5 SASI_Rn02_00239743 predicted 2224
6 SASI_Rn02_00239744 predicted 1925
7 SASI_Rn02_00239745 predicted 961
8 SASI_Rn02_00239746 predicted 2627
9 SASI_Rn02_00239747 predicted 600
10 SASI_Rn02_00239748 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041746 predicted 979
2 SASI_Mm01_00041747 predicted 1824
3 SASI_Mm01_00041748 predicted 2606
4 SASI_Mm02_00325923 predicted 1452
5 SASI_Mm01_00041751 predicted 456
6 SASI_Mm01_00041752 predicted 2461
7 SASI_Mm02_00325924 predicted 686
8 SASI_Mm01_00041753 predicted 1590
9 SASI_Mm01_00041754 predicted 296
10 SASI_Mm01_00041755 predicted 2261
11 SASI_Mm01_00041749 predicted 1274
12 SASI_Mm01_00041750 predicted 1308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145207
SPATA5 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145207.1-3024s1c1
Sequence:CCGGCATCCCATGAAGCAATTTCTTCTCGAGAAGAAATTGCTTCATGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145207.1-3078s1c1
Sequence:CCGGGCCAAACATGTTGGCATCAATCTCGAGATTGATGCCAACATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145207.1-1007s1c1
Sequence:CCGGGCATAGGAGCAAAGTGCAATACTCGAGTATTGCACTTTGCTCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145207.1-1291s1c1
Sequence:CCGGGCTAATGAAGTTGGAGCCTATCTCGAGATAGGCTCCAACTTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145207.1-2934s1c1
Sequence:CCGGGAGCATAAGTTTCAATCAGTTCTCGAGAACTGATTGAAACTTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145207.1-3079s1c1
Sequence:CCGGCCAAACATGTTGGCATCAATTCTCGAGAATTGATGCCAACATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-348s21c1
Sequence:CCGGACGGAAAGCAAGAGGTGTATACTCGAGTATACACCTCTTGCTTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-632s21c1
Sequence:CCGGCCGTACAAGCTGCAAGTATTGCTCGAGCAATACTTGCAGCTTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145207.2-3025s21c1
Sequence:CCGGGTTCATCCCATGAAGCGATTTCTCGAGAAATCGCTTCATGGGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-208s21c1
Sequence:CCGGTCTGACGGTGACCAACTTATTCTCGAGAATAAGTTGGTCACCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145207
SPATA5 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145207.1-3024s1c1
Sequence:CCGGCATCCCATGAAGCAATTTCTTCTCGAGAAGAAATTGCTTCATGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145207.1-3078s1c1
Sequence:CCGGGCCAAACATGTTGGCATCAATCTCGAGATTGATGCCAACATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145207.1-1007s1c1
Sequence:CCGGGCATAGGAGCAAAGTGCAATACTCGAGTATTGCACTTTGCTCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145207.1-1291s1c1
Sequence:CCGGGCTAATGAAGTTGGAGCCTATCTCGAGATAGGCTCCAACTTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145207.1-2934s1c1
Sequence:CCGGGAGCATAAGTTTCAATCAGTTCTCGAGAACTGATTGAAACTTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145207.1-3079s1c1
Sequence:CCGGCCAAACATGTTGGCATCAATTCTCGAGAATTGATGCCAACATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-348s21c1
Sequence:CCGGACGGAAAGCAAGAGGTGTATACTCGAGTATACACCTCTTGCTTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-632s21c1
Sequence:CCGGCCGTACAAGCTGCAAGTATTGCTCGAGCAATACTTGCAGCTTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145207.2-3025s21c1
Sequence:CCGGGTTCATCCCATGAAGCGATTTCTCGAGAAATCGCTTCATGGGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-208s21c1
Sequence:CCGGTCTGACGGTGACCAACTTATTCTCGAGAATAAGTTGGTCACCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145207
SPATA5 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145207.1-3024s1c1
Sequence:CCGGCATCCCATGAAGCAATTTCTTCTCGAGAAGAAATTGCTTCATGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149306    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145207.1-3078s1c1
Sequence:CCGGGCCAAACATGTTGGCATCAATCTCGAGATTGATGCCAACATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145207.1-1007s1c1
Sequence:CCGGGCATAGGAGCAAAGTGCAATACTCGAGTATTGCACTTTGCTCCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145207.1-1291s1c1
Sequence:CCGGGCTAATGAAGTTGGAGCCTATCTCGAGATAGGCTCCAACTTCATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145207.1-2934s1c1
Sequence:CCGGGAGCATAAGTTTCAATCAGTTCTCGAGAACTGATTGAAACTTATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182975    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145207.1-3079s1c1
Sequence:CCGGCCAAACATGTTGGCATCAATTCTCGAGAATTGATGCCAACATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-348s21c1
Sequence:CCGGACGGAAAGCAAGAGGTGTATACTCGAGTATACACCTCTTGCTTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-632s21c1
Sequence:CCGGCCGTACAAGCTGCAAGTATTGCTCGAGCAATACTTGCAGCTTGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145207.2-3025s21c1
Sequence:CCGGGTTCATCCCATGAAGCGATTTCTCGAGAAATCGCTTCATGGGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145207.2-208s21c1
Sequence:CCGGTCTGACGGTGACCAACTTATTCTCGAGAATAAGTTGGTCACCGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021343
VALIDATED
SPATA5 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1233s1c1
Sequence:CCGGCCGGAAAGACAATGATTGCTACTCGAGTAGCAATCATTGTCTTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-2480s1c1
Sequence:CCGGCCGATCAGTAACGAGGTTGATCTCGAGATCAACCTCGTTACTGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-2392s1c1
Sequence:CCGGGCCTGGAAGAATTGACAGGATCTCGAGATCCTGTCAATTCTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1625s1c1
Sequence:CCGGCGGCTTGATATTCTCCAGAAACTCGAGTTTCTGGAGAATATCAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1977s1c1
Sequence:CCGGCCTTGAAACATCCTAAGTCTTCTCGAGAAGACTTAGGATGTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-2098s21c1
Sequence:CCGGGTTGAACTTTCTAGCTATAAACTCGAGTTTATAGCTAGAAAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1337s21c1
Sequence:CCGGGCAAGGTTACGCCAGATATTTCTCGAGAAATATCTGGCGTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1193s21c1
Sequence:CCGGCCAGCGCCTAGAGGGTTATTACTCGAGTAATAACCCTCTAGGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1097s21c1
Sequence:CCGGGACATGATTGGAGGCTTAAACCTCGAGGTTTAAGCCTCCAATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021343
VALIDATED
SPATA5 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1233s1c1
Sequence:CCGGCCGGAAAGACAATGATTGCTACTCGAGTAGCAATCATTGTCTTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-2480s1c1
Sequence:CCGGCCGATCAGTAACGAGGTTGATCTCGAGATCAACCTCGTTACTGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-2392s1c1
Sequence:CCGGGCCTGGAAGAATTGACAGGATCTCGAGATCCTGTCAATTCTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1625s1c1
Sequence:CCGGCGGCTTGATATTCTCCAGAAACTCGAGTTTCTGGAGAATATCAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1977s1c1
Sequence:CCGGCCTTGAAACATCCTAAGTCTTCTCGAGAAGACTTAGGATGTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-2098s21c1
Sequence:CCGGGTTGAACTTTCTAGCTATAAACTCGAGTTTATAGCTAGAAAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1337s21c1
Sequence:CCGGGCAAGGTTACGCCAGATATTTCTCGAGAAATATCTGGCGTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1193s21c1
Sequence:CCGGCCAGCGCCTAGAGGGTTATTACTCGAGTAATAACCCTCTAGGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1097s21c1
Sequence:CCGGGACATGATTGGAGGCTTAAACCTCGAGGTTTAAGCCTCCAATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021343
VALIDATED
SPATA5 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1233s1c1
Sequence:CCGGCCGGAAAGACAATGATTGCTACTCGAGTAGCAATCATTGTCTTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-2480s1c1
Sequence:CCGGCCGATCAGTAACGAGGTTGATCTCGAGATCAACCTCGTTACTGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-2392s1c1
Sequence:CCGGGCCTGGAAGAATTGACAGGATCTCGAGATCCTGTCAATTCTTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1625s1c1
Sequence:CCGGCGGCTTGATATTCTCCAGAAACTCGAGTTTCTGGAGAATATCAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021343.1-1977s1c1
Sequence:CCGGCCTTGAAACATCCTAAGTCTTCTCGAGAAGACTTAGGATGTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-2098s21c1
Sequence:CCGGGTTGAACTTTCTAGCTATAAACTCGAGTTTATAGCTAGAAAGTTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1337s21c1
Sequence:CCGGGCAAGGTTACGCCAGATATTTCTCGAGAAATATCTGGCGTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1193s21c1
Sequence:CCGGCCAGCGCCTAGAGGGTTATTACTCGAGTAATAACCCTCTAGGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021343.1-1097s21c1
Sequence:CCGGGACATGATTGGAGGCTTAAACCTCGAGGTTTAAGCCTCCAATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks