EMAIL THIS PAGE TO A FRIEND

SPATA5L1

spermatogenesis associated 5-like 1

UniProtKB ID: Q9BVQ7, C9JHR5, Q9H8W7, Q9HA41
Gene ID:
Mouse(214616) spermatogenesis associated 5-like 1
Rat(691729) spermatogenesis associated 5-like 1
cow(533070) spermatogenesis associated 5-like 1
sheep(101111199) spermatogenesis associated 5-like 1
domestic guinea pig(100734638) spermatogenesis associated 5-like 1
naked mole-rat(101726553) spermatogenesis associated 5-like 1
Domestic Rabbit(100355145) spermatogenesis associated 5-like 1
Zebrafish(767648) spermatogenesis associated 5-like 1
chicken(415441) spermatogenesis associated 5-like 1
dog(609256) spermatogenesis associated 5-like 1
domestic cat(101086482) spermatogenesis associated 5-like 1
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024063 Rosetta Predictions human pricing
NM_001109647 Rosetta Predictions rat pricing
XM_001479997 Rosetta Predictions mouse pricing
XM_001481333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356517 predicted 1483
2 SASI_Hs01_00153922 predicted 1320
3 SASI_Hs01_00153923 predicted 1825
4 SASI_Hs02_00356518 predicted 1394
5 SASI_Hs01_00153925 predicted 1326
6 SASI_Hs01_00153926 predicted 1863
7 SASI_Hs01_00153927 predicted 1470
8 SASI_Hs01_00153928 predicted 1176
9 SASI_Hs01_00153929 predicted 1776
10 SASI_Hs01_00153930 predicted 1108
11 SASI_Hs01_00153921 predicted 1163
12 SASI_Hs01_00153924 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250402 predicted 2081
2 SASI_Rn02_00250403 predicted 1964
3 SASI_Rn02_00250404 predicted 1946
4 SASI_Rn02_00250405 predicted 262
5 SASI_Rn02_00250406 predicted 1445
6 SASI_Rn02_00250407 predicted 2040
7 SASI_Rn02_00250408 predicted 1161
8 SASI_Rn02_00250409 predicted 1832
9 SASI_Rn02_00250410 predicted 1846
10 SASI_Rn02_00250411 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00414257 predicted 1157
2 SASI_Mm02_00414258 predicted 1202
3 SASI_Mm02_00414259 predicted 1044
4 SASI_Mm02_00414260 predicted 1159
5 SASI_Mm02_00414261 predicted 871
6 SASI_Mm02_00414262 predicted 1114
7 SASI_Mm02_00414263 predicted 1199
8 SASI_Mm02_00414264 predicted 1137
9 SASI_Mm02_00414265 predicted 1114
10 SASI_Mm02_00414266 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423788 predicted 1430
2 SASI_Mm02_00423789 predicted 1476
3 SASI_Mm02_00423790 predicted 1162
4 SASI_Mm02_00423791 predicted 1451
5 SASI_Mm02_00423792 predicted 1204
6 SASI_Mm02_00423793 predicted 1825
7 SASI_Mm02_00423794 predicted 1310
8 SASI_Mm02_00423795 predicted 1232
9 SASI_Mm02_00423796 predicted 1041
10 SASI_Mm02_00423797 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024063
VALIDATED
SPATA5L1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 5-like 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-1449s21c1
Sequence:CCGGCATCGTTTCGAAGCGTCATTGCTCGAGCAATGACGCTTCGAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-2350s21c1
Sequence:CCGGTTCTAACGTGGAAGGTATTTACTCGAGTAAATACCTTCCACGTTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-1963s21c1
Sequence:CCGGTAACCGAAGTGTCATGATTATCTCGAGATAATCATGACACTTCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-2384s21c1
Sequence:CCGGACTCTTGTTCAGTTCACATTACTCGAGTAATGTGAACTGAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024063.2-2026s21c1
Sequence:CCGGACGACCTGGAAGATTAGATAACTCGAGTTATCTAATCTTCCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1489s1c1
Sequence:CCGGCCTCTGAAATTCCCTTGGGAACTCGAGTTCCCAAGGGAATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024063.1-1949s1c1
Sequence:CCGGCTGCTTTGTTACGACCTGGAACTCGAGTTCCAGGTCGTAACAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024063.1-1604s1c1
Sequence:CCGGGCTGTCACTGCTCTTTCGTTTCTCGAGAAACGAAAGAGCAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-78s1c1
Sequence:CCGGGCTCTTAAAGCTGCTACCCTTCTCGAGAAGGGTAGCAGCTTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1176s1c1
Sequence:CCGGGCAAGTGATTACCTCGAAGATCTCGAGATCTTCGAGGTAATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1394s1c1
Sequence:CCGGGCGTCATTGGATTAATGGATACTCGAGTATCCATTAATCCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1500s1c1
Sequence:CCGGCCCTTGGGAATTTGTTAGAATCTCGAGATTCTAACAAATTCCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024063
VALIDATED
SPATA5L1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 5-like 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-1449s21c1
Sequence:CCGGCATCGTTTCGAAGCGTCATTGCTCGAGCAATGACGCTTCGAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-2350s21c1
Sequence:CCGGTTCTAACGTGGAAGGTATTTACTCGAGTAAATACCTTCCACGTTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-1963s21c1
Sequence:CCGGTAACCGAAGTGTCATGATTATCTCGAGATAATCATGACACTTCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-2384s21c1
Sequence:CCGGACTCTTGTTCAGTTCACATTACTCGAGTAATGTGAACTGAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024063.2-2026s21c1
Sequence:CCGGACGACCTGGAAGATTAGATAACTCGAGTTATCTAATCTTCCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1489s1c1
Sequence:CCGGCCTCTGAAATTCCCTTGGGAACTCGAGTTCCCAAGGGAATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024063.1-1949s1c1
Sequence:CCGGCTGCTTTGTTACGACCTGGAACTCGAGTTCCAGGTCGTAACAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024063.1-1604s1c1
Sequence:CCGGGCTGTCACTGCTCTTTCGTTTCTCGAGAAACGAAAGAGCAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-78s1c1
Sequence:CCGGGCTCTTAAAGCTGCTACCCTTCTCGAGAAGGGTAGCAGCTTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1176s1c1
Sequence:CCGGGCAAGTGATTACCTCGAAGATCTCGAGATCTTCGAGGTAATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1394s1c1
Sequence:CCGGGCGTCATTGGATTAATGGATACTCGAGTATCCATTAATCCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1500s1c1
Sequence:CCGGCCCTTGGGAATTTGTTAGAATCTCGAGATTCTAACAAATTCCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024063
VALIDATED
SPATA5L1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 5-like 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-1449s21c1
Sequence:CCGGCATCGTTTCGAAGCGTCATTGCTCGAGCAATGACGCTTCGAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-2350s21c1
Sequence:CCGGTTCTAACGTGGAAGGTATTTACTCGAGTAAATACCTTCCACGTTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-1963s21c1
Sequence:CCGGTAACCGAAGTGTCATGATTATCTCGAGATAATCATGACACTTCGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024063.2-2384s21c1
Sequence:CCGGACTCTTGTTCAGTTCACATTACTCGAGTAATGTGAACTGAACAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024063.2-2026s21c1
Sequence:CCGGACGACCTGGAAGATTAGATAACTCGAGTTATCTAATCTTCCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1489s1c1
Sequence:CCGGCCTCTGAAATTCCCTTGGGAACTCGAGTTCCCAAGGGAATTTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024063.1-1949s1c1
Sequence:CCGGCTGCTTTGTTACGACCTGGAACTCGAGTTCCAGGTCGTAACAAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024063.1-1604s1c1
Sequence:CCGGGCTGTCACTGCTCTTTCGTTTCTCGAGAAACGAAAGAGCAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-78s1c1
Sequence:CCGGGCTCTTAAAGCTGCTACCCTTCTCGAGAAGGGTAGCAGCTTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1176s1c1
Sequence:CCGGGCAAGTGATTACCTCGAAGATCTCGAGATCTTCGAGGTAATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1394s1c1
Sequence:CCGGGCGTCATTGGATTAATGGATACTCGAGTATCCATTAATCCAATGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024063.1-1500s1c1
Sequence:CCGGCCCTTGGGAATTTGTTAGAATCTCGAGATTCTAACAAATTCCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033256
VALIDATED
SPATA5L1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 5-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033256.1-1124s1c1
Sequence:CCGGGTTTGACAGAGAGGTTGTCATCTCGAGATGACAACCTCTCTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1181s1c1
Sequence:CCGGGCAAGTGATTACTTCAAAGATCTCGAGATCTTTGAAGTAATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1187s1c1
Sequence:CCGGGATTACTTCAAAGATGCCCATCTCGAGATGGGCATCTTTGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-326s1c1
Sequence:CCGGGAGGATAGGTATGGACTGCTTCTCGAGAAGCAGTCCATACCTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-1327s1c1
Sequence:CCGGGAAGGTGGGAAGAAGTTATGTCTCGAGACATAACTTCTTCCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-1211s1c1
Sequence:CCGGCAGTCATATTGATTTAGGTCTCTCGAGAGACCTAAATCAATATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033256.1-1205s1c1
Sequence:CCGGCATCTCCAGTCATATTGATTTCTCGAGAAATCAATATGACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1157s1c1
Sequence:CCGGCCTTAAACAAAGAGAAGCAATCTCGAGATTGCTTCTCTTTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033256
VALIDATED
SPATA5L1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 5-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033256.1-1124s1c1
Sequence:CCGGGTTTGACAGAGAGGTTGTCATCTCGAGATGACAACCTCTCTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1181s1c1
Sequence:CCGGGCAAGTGATTACTTCAAAGATCTCGAGATCTTTGAAGTAATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1187s1c1
Sequence:CCGGGATTACTTCAAAGATGCCCATCTCGAGATGGGCATCTTTGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-326s1c1
Sequence:CCGGGAGGATAGGTATGGACTGCTTCTCGAGAAGCAGTCCATACCTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-1327s1c1
Sequence:CCGGGAAGGTGGGAAGAAGTTATGTCTCGAGACATAACTTCTTCCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-1211s1c1
Sequence:CCGGCAGTCATATTGATTTAGGTCTCTCGAGAGACCTAAATCAATATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033256.1-1205s1c1
Sequence:CCGGCATCTCCAGTCATATTGATTTCTCGAGAAATCAATATGACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1157s1c1
Sequence:CCGGCCTTAAACAAAGAGAAGCAATCTCGAGATTGCTTCTCTTTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033256
VALIDATED
SPATA5L1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 5-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033256.1-1124s1c1
Sequence:CCGGGTTTGACAGAGAGGTTGTCATCTCGAGATGACAACCTCTCTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1181s1c1
Sequence:CCGGGCAAGTGATTACTTCAAAGATCTCGAGATCTTTGAAGTAATCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1187s1c1
Sequence:CCGGGATTACTTCAAAGATGCCCATCTCGAGATGGGCATCTTTGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-326s1c1
Sequence:CCGGGAGGATAGGTATGGACTGCTTCTCGAGAAGCAGTCCATACCTATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-1327s1c1
Sequence:CCGGGAAGGTGGGAAGAAGTTATGTCTCGAGACATAACTTCTTCCCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033256.1-1211s1c1
Sequence:CCGGCAGTCATATTGATTTAGGTCTCTCGAGAGACCTAAATCAATATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001033256.1-1205s1c1
Sequence:CCGGCATCTCCAGTCATATTGATTTCTCGAGAAATCAATATGACTGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033256.1-1157s1c1
Sequence:CCGGCCTTAAACAAAGAGAAGCAATCTCGAGATTGCTTCTCTTTGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks