EMAIL THIS PAGE TO A FRIEND

SPATA6

spermatogenesis associated 6

Synonyms: HASH SRF-1 SRF1
UniProtKB ID: Q9NWH7, Q5T3N7, Q8WUE6
Gene ID:
Mouse(67946) spermatogenesis associated 6
Rat(171413) spermatogenesis associated 6
Zebrafish(550512) spermatogenesis associated 6
chicken(424626) spermatogenesis associated 6
domestic cat(101098559) spermatogenesis associated 6
dog(475364) spermatogenesis associated 6
Domestic Rabbit(100353937) spermatogenesis associated 6
naked mole-rat(101700288) spermatogenesis associated 6
domestic guinea pig(100726250) spermatogenesis associated 6
cow(534169) spermatogenesis associated 6
sheep(101107397) spermatogenesis associated 6
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026470 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026470 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026470 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019073 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019073 Rosetta Predictions human pricing
NM_134392 Rosetta Predictions rat pricing
XM_579634 Rosetta Predictions rat pricing
NM_026470 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029780 predicted 531
2 SASI_Hs01_00029781 predicted 1022
3 SASI_Hs01_00029782 predicted 729
4 SASI_Hs01_00029783 predicted 965
5 SASI_Hs01_00029785 predicted 742
6 SASI_Hs01_00029786 predicted 1087
7 SASI_Hs01_00029787 predicted 1475
8 SASI_Hs01_00029788 predicted 522
9 SASI_Hs01_00029789 predicted 1316
10 SASI_Hs02_00352664 predicted 1198
11 SASI_Hs01_00029784 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134392 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051377 predicted 860
2 SASI_Rn01_00051378 predicted 846
3 SASI_Rn02_00267959 predicted 1954
4 SASI_Rn01_00051379 predicted 1349
5 SASI_Rn01_00051380 predicted 1530
6 SASI_Rn01_00051381 predicted 667
7 SASI_Rn01_00051382 predicted 780
8 SASI_Rn01_00051383 predicted 1028
9 SASI_Rn02_00267960 predicted 1627
10 SASI_Rn01_00051386 predicted 1903
11 SASI_Rn01_00051384 predicted 912
12 SASI_Rn01_00051385 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147916 predicted 1313
2 SASI_Rn01_00147917 predicted 1194
3 SASI_Rn01_00147918 predicted 1227
4 SASI_Rn01_00147919 predicted 1311
5 SASI_Rn01_00147920 predicted 1205
6 SASI_Rn01_00147921 predicted 1254
7 SASI_Rn01_00147922 predicted 1378
8 SASI_Rn01_00147923 predicted 1291
9 SASI_Rn01_00147924 predicted 1327
10 SASI_Rn01_00147925 predicted 1215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077984 predicted 572
2 SASI_Mm01_00077985 predicted 779
3 SASI_Mm02_00330338 predicted 236
4 SASI_Mm01_00077986 predicted 580
5 SASI_Mm02_00330339 predicted 1142
6 SASI_Mm01_00077988 predicted 634
7 SASI_Mm02_00330340 predicted 284
8 SASI_Mm02_00330341 predicted 1306
9 SASI_Mm01_00077991 predicted 411
10 SASI_Mm01_00077992 predicted 550
11 SASI_Mm01_00077987 predicted 2258
12 SASI_Mm01_00077989 predicted 1683
13 SASI_Mm01_00077990 predicted 1774
14 SASI_Mm01_00077993 predicted 1632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026470
VALIDATED
SPATA6 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.2-2005s1c1
Sequence:CCGGCACAGCGATCATCCTCATATTCTCGAGAATATGAGGATGATCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.2-2491s1c1
Sequence:CCGGGCAGCCTCTTGTAAAGGGAAACTCGAGTTTCCCTTTACAAGAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-772s21c1
Sequence:CCGGAGTCACCCGAGAGGAGTAAATCTCGAGATTTACTCCTCTCGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-811s21c1
Sequence:CCGGACTACGAACAGCCTACGATTTCTCGAGAAATCGTAGGCTGTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-546s21c1
Sequence:CCGGTCTGGACACCATGATTCAAACCTCGAGGTTTGAATCATGGTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026470.3-1775s1c1
Sequence:CCGGGAGTTGAACCCAGCATATTTCCTCGAGGAAATATGCTGGGTTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026470.3-2280s1c1
Sequence:CCGGGTCATTCATGTAGCTAATATTCTCGAGAATATTAGCTACATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.3-673s1c1
Sequence:CCGGGCCGCACTCAGGATAAATTTACTCGAGTAAATTTATCCTGAGTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-1328s21c1
Sequence:CCGGTGAGATCCATGACCGGGTAAACTCGAGTTTACCCGGTCATGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026470.3-2280s21c1
Sequence:CCGGGTCATTCATGTAGCTAATATTCTCGAGAATATTAGCTACATGAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026470
VALIDATED
SPATA6 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.2-2005s1c1
Sequence:CCGGCACAGCGATCATCCTCATATTCTCGAGAATATGAGGATGATCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.2-2491s1c1
Sequence:CCGGGCAGCCTCTTGTAAAGGGAAACTCGAGTTTCCCTTTACAAGAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-772s21c1
Sequence:CCGGAGTCACCCGAGAGGAGTAAATCTCGAGATTTACTCCTCTCGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-811s21c1
Sequence:CCGGACTACGAACAGCCTACGATTTCTCGAGAAATCGTAGGCTGTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-546s21c1
Sequence:CCGGTCTGGACACCATGATTCAAACCTCGAGGTTTGAATCATGGTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026470.3-1775s1c1
Sequence:CCGGGAGTTGAACCCAGCATATTTCCTCGAGGAAATATGCTGGGTTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026470.3-2280s1c1
Sequence:CCGGGTCATTCATGTAGCTAATATTCTCGAGAATATTAGCTACATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.3-673s1c1
Sequence:CCGGGCCGCACTCAGGATAAATTTACTCGAGTAAATTTATCCTGAGTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-1328s21c1
Sequence:CCGGTGAGATCCATGACCGGGTAAACTCGAGTTTACCCGGTCATGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026470.3-2280s21c1
Sequence:CCGGGTCATTCATGTAGCTAATATTCTCGAGAATATTAGCTACATGAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026470
VALIDATED
SPATA6 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.2-2005s1c1
Sequence:CCGGCACAGCGATCATCCTCATATTCTCGAGAATATGAGGATGATCGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.2-2491s1c1
Sequence:CCGGGCAGCCTCTTGTAAAGGGAAACTCGAGTTTCCCTTTACAAGAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-772s21c1
Sequence:CCGGAGTCACCCGAGAGGAGTAAATCTCGAGATTTACTCCTCTCGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-811s21c1
Sequence:CCGGACTACGAACAGCCTACGATTTCTCGAGAAATCGTAGGCTGTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-546s21c1
Sequence:CCGGTCTGGACACCATGATTCAAACCTCGAGGTTTGAATCATGGTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216787    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026470.3-1775s1c1
Sequence:CCGGGAGTTGAACCCAGCATATTTCCTCGAGGAAATATGCTGGGTTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216551    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026470.3-2280s1c1
Sequence:CCGGGTCATTCATGTAGCTAATATTCTCGAGAATATTAGCTACATGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026470.3-673s1c1
Sequence:CCGGGCCGCACTCAGGATAAATTTACTCGAGTAAATTTATCCTGAGTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026470.3-1328s21c1
Sequence:CCGGTGAGATCCATGACCGGGTAAACTCGAGTTTACCCGGTCATGGATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026470.3-2280s21c1
Sequence:CCGGGTCATTCATGTAGCTAATATTCTCGAGAATATTAGCTACATGAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019073
SPATA6 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-1226s1c1
Sequence:CCGGGCCCTGTGTTAAATAGAGCTTCTCGAGAAGCTCTATTTAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-599s1c1
Sequence:CCGGCGACTTCAGTGATTACTGAATCTCGAGATTCAGTAATCACTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-925s1c1
Sequence:CCGGCCTCCATTTGTGATTAGACATCTCGAGATGTCTAATCACAAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-1479s1c1
Sequence:CCGGCCATTTGGATGACGGTGAATACTCGAGTATTCACCGTCATCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-838s1c1
Sequence:CCGGCGCATGTGTGAGCTATCTGAACTCGAGTTCAGATAGCTCACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019073
SPATA6 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-1226s1c1
Sequence:CCGGGCCCTGTGTTAAATAGAGCTTCTCGAGAAGCTCTATTTAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-599s1c1
Sequence:CCGGCGACTTCAGTGATTACTGAATCTCGAGATTCAGTAATCACTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-925s1c1
Sequence:CCGGCCTCCATTTGTGATTAGACATCTCGAGATGTCTAATCACAAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-1479s1c1
Sequence:CCGGCCATTTGGATGACGGTGAATACTCGAGTATTCACCGTCATCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-838s1c1
Sequence:CCGGCGCATGTGTGAGCTATCTGAACTCGAGTTCAGATAGCTCACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019073
SPATA6 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-1226s1c1
Sequence:CCGGGCCCTGTGTTAAATAGAGCTTCTCGAGAAGCTCTATTTAACACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-599s1c1
Sequence:CCGGCGACTTCAGTGATTACTGAATCTCGAGATTCAGTAATCACTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-925s1c1
Sequence:CCGGCCTCCATTTGTGATTAGACATCTCGAGATGTCTAATCACAAATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-1479s1c1
Sequence:CCGGCCATTTGGATGACGGTGAATACTCGAGTATTCACCGTCATCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019073.1-838s1c1
Sequence:CCGGCGCATGTGTGAGCTATCTGAACTCGAGTTCAGATAGCTCACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks