EMAIL THIS PAGE TO A FRIEND

SPATA6L

spermatogenesis associated 6-like

Synonyms: C9orf68 bA6J24.2
UniProtKB ID: Q8N4H0, B4DIY4, Q5JVJ5, Q8IY90
Gene ID:
cow(613587) spermatogenesis associated 6-like
sheep(101112453) spermatogenesis associated 6-like
domestic guinea pig(100720714) spermatogenesis associated 6-like
naked mole-rat(101714784) spermatogenesis associated 6-like
Zebrafish(393384) spermatogenesis associated 6-like
domestic cat(101089471) spermatogenesis associated 6-like
dog(609582) spermatogenesis associated 6-like
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017985 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039395 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308482 predicted 1299
2 SASI_Hs02_00308483 predicted 247
3 SASI_Hs01_00191217 predicted 955
4 SASI_Hs02_00308484 predicted 679
5 SASI_Hs02_00308485 predicted 1443
6 SASI_Hs02_00308486 predicted 703
7 SASI_Hs02_00308487 predicted 262
8 SASI_Hs02_00308488 predicted 1005
9 SASI_Hs02_00308489 predicted 1219
10 SASI_Hs02_00308490 predicted 1117
11 SASI_Hs01_00191216 predicted 1131
12 SASI_Hs01_00191218 predicted 1142
13 SASI_Hs01_00191219 predicted 944
14 SASI_Hs01_00191220 predicted 864
15 SASI_Hs01_00191221 predicted 1100
16 SASI_Hs01_00191222 predicted 1091
17 SASI_Hs01_00191223 predicted 1000
18 SASI_Hs01_00191224 predicted 1006
19 SASI_Hs01_00191225 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017985
SPATA6L MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 6-like
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-634s1c1
Sequence:CCGGCTACATCACATGAACCAATATCTCGAGATATTGGTTCATGTGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-408s1c1
Sequence:CCGGGAGTTGGCCTACTACGAAGAACTCGAGTTCTTCGTAGTAGGCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-852s1c1
Sequence:CCGGGCAAAGCCCTTTGGTGAGAATCTCGAGATTCTCACCAAAGGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-236s1c1
Sequence:CCGGGCCTGGCAAACAAGATGTGTACTCGAGTACACATCTTGTTTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017985
SPATA6L MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 6-like
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-634s1c1
Sequence:CCGGCTACATCACATGAACCAATATCTCGAGATATTGGTTCATGTGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-408s1c1
Sequence:CCGGGAGTTGGCCTACTACGAAGAACTCGAGTTCTTCGTAGTAGGCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-852s1c1
Sequence:CCGGGCAAAGCCCTTTGGTGAGAATCTCGAGATTCTCACCAAAGGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-236s1c1
Sequence:CCGGGCCTGGCAAACAAGATGTGTACTCGAGTACACATCTTGTTTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017985
SPATA6L MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 6-like
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-634s1c1
Sequence:CCGGCTACATCACATGAACCAATATCTCGAGATATTGGTTCATGTGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180347    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-408s1c1
Sequence:CCGGGAGTTGGCCTACTACGAAGAACTCGAGTTCTTCGTAGTAGGCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180880    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-852s1c1
Sequence:CCGGGCAAAGCCCTTTGGTGAGAATCTCGAGATTCTCACCAAAGGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017985.2-236s1c1
Sequence:CCGGGCCTGGCAAACAAGATGTGTACTCGAGTACACATCTTGTTTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks