EMAIL THIS PAGE TO A FRIEND

SPATA7

spermatogenesis associated 7

Synonyms: HSD-3.1 HSD3 LCA3
UniProtKB ID: Q9P0W8, Q5BKY5, Q8WX30, Q96HF3, Q9H0X0, Q9P0W7
Gene ID:
Human(55812) Summary: This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Mouse(104871) spermatogenesis associated 7
Rat(192225) spermatogenesis associated 7
Zebrafish(100318631) spermatogenesis associated 7
domestic cat(101091949) spermatogenesis associated 7
Horse(100061948) spermatogenesis associated 7
dog(480411) spermatogenesis associated 7
chicken(423397) spermatogenesis associated 7
naked mole-rat(101720590) spermatogenesis associated 7
domestic guinea pig(100732301) spermatogenesis associated 7
cow(510352) spermatogenesis associated 7
sheep(101118616) spermatogenesis associated 7
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018418 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040428 Rosetta Predictions human pricing
NM_018418 Rosetta Predictions human pricing
NM_138862 Rosetta Predictions rat pricing
XM_579657 Rosetta Predictions rat pricing
NM_178914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187308 predicted 510
2 SASI_Hs01_00187309 predicted 958
3 SASI_Hs01_00187310 predicted 1624
4 SASI_Hs01_00187311 predicted 1132
5 SASI_Hs02_00308954 predicted 1150
6 SASI_Hs01_00187312 predicted 1038
7 SASI_Hs01_00187314 predicted 967
8 SASI_Hs01_00187315 predicted 1479
9 SASI_Hs02_00308955 predicted 950
10 SASI_Hs02_00308956 predicted 1050
11 SASI_Hs01_00187306 predicted 1574
12 SASI_Hs01_00187307 predicted 1154
13 SASI_Hs01_00187313 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127929 predicted 607
2 SASI_Hs01_00127930 predicted 1062
3 SASI_Hs01_00127931 predicted 1722
4 SASI_Hs01_00127932 predicted 1231
5 SASI_Hs02_00351926 predicted 1243
6 SASI_Hs01_00127933 predicted 1143
7 SASI_Hs01_00127935 predicted 1067
8 SASI_Hs01_00127936 predicted 1576
9 SASI_Hs02_00351927 predicted 1053
10 SASI_Hs02_00351928 predicted 1140
11 SASI_Hs01_00127927 predicted 1660
12 SASI_Hs01_00127928 predicted 1245
13 SASI_Hs01_00127934 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047768 predicted 809
2 SASI_Rn01_00047769 predicted 461
3 SASI_Rn01_00047771 predicted 759
4 SASI_Rn02_00268268 predicted 1017
5 SASI_Rn02_00268269 predicted 929
6 SASI_Rn01_00047772 predicted 1535
7 SASI_Rn01_00047773 predicted 1323
8 SASI_Rn01_00047774 predicted 1526
9 SASI_Rn01_00047775 predicted 1162
10 SASI_Rn01_00047776 predicted 1325
11 SASI_Rn01_00047770 predicted 1219
12 SASI_Rn01_00047777 predicted 1894
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156105 predicted 1401
2 SASI_Rn01_00156106 predicted 1442
3 SASI_Rn01_00156107 predicted 1386
4 SASI_Rn01_00156108 predicted 1447
5 SASI_Rn01_00156109 predicted 1348
6 SASI_Rn01_00156110 predicted 1349
7 SASI_Rn01_00156111 predicted 1336
8 SASI_Rn01_00156112 predicted 1302
9 SASI_Rn01_00156113 predicted 1335
10 SASI_Rn01_00156114 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043948 predicted 856
2 SASI_Mm01_00043949 predicted 1067
3 SASI_Mm01_00043950 predicted 1224
4 SASI_Mm01_00043951 predicted 448
5 SASI_Mm01_00043952 predicted 797
6 SASI_Mm01_00043954 predicted 1605
7 SASI_Mm02_00349529 predicted 897
8 SASI_Mm01_00043956 predicted 326
9 SASI_Mm02_00349530 predicted 351
10 SASI_Mm01_00043957 predicted 360
11 SASI_Mm01_00043953 predicted 1681
12 SASI_Mm01_00043955 predicted 1221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178914
SPATA7 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 7
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-1264s1c1
Sequence:CCGGCGACTGTTTGAGCGACATATACTCGAGTATATGTCGCTCAAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-921s1c1
Sequence:CCGGCCAAACTGAATTAAGCAGCTTCTCGAGAAGCTGCTTAATTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-804s1c1
Sequence:CCGGGCCATTCACTCCACGAACTTTCTCGAGAAAGTTCGTGGAGTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-1882s1c1
Sequence:CCGGCCTCTGGATCTACATTAATAACTCGAGTTATTAATGTAGATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-352s21c1
Sequence:CCGGGTGAATACTAGCATCAAATATCTCGAGATATTTGATGCTAGTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-283s21c1
Sequence:CCGGCACATGGCTATTCACTATAATCTCGAGATTATAGTGAATAGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178914.3-1911s21c1
Sequence:CCGGTGTGGCCAGTAACTCAATATTCTCGAGAATATTGAGTTACTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-1593s21c1
Sequence:CCGGGCATTCAGAGGGTGTTATAATCTCGAGATTATAACACCCTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178914
SPATA7 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 7
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-1264s1c1
Sequence:CCGGCGACTGTTTGAGCGACATATACTCGAGTATATGTCGCTCAAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-921s1c1
Sequence:CCGGCCAAACTGAATTAAGCAGCTTCTCGAGAAGCTGCTTAATTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-804s1c1
Sequence:CCGGGCCATTCACTCCACGAACTTTCTCGAGAAAGTTCGTGGAGTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-1882s1c1
Sequence:CCGGCCTCTGGATCTACATTAATAACTCGAGTTATTAATGTAGATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-352s21c1
Sequence:CCGGGTGAATACTAGCATCAAATATCTCGAGATATTTGATGCTAGTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-283s21c1
Sequence:CCGGCACATGGCTATTCACTATAATCTCGAGATTATAGTGAATAGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178914.3-1911s21c1
Sequence:CCGGTGTGGCCAGTAACTCAATATTCTCGAGAATATTGAGTTACTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-1593s21c1
Sequence:CCGGGCATTCAGAGGGTGTTATAATCTCGAGATTATAACACCCTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178914
SPATA7 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 7
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-1264s1c1
Sequence:CCGGCGACTGTTTGAGCGACATATACTCGAGTATATGTCGCTCAAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-921s1c1
Sequence:CCGGCCAAACTGAATTAAGCAGCTTCTCGAGAAGCTGCTTAATTCAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-804s1c1
Sequence:CCGGGCCATTCACTCCACGAACTTTCTCGAGAAAGTTCGTGGAGTGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178914.3-1882s1c1
Sequence:CCGGCCTCTGGATCTACATTAATAACTCGAGTTATTAATGTAGATCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-352s21c1
Sequence:CCGGGTGAATACTAGCATCAAATATCTCGAGATATTTGATGCTAGTATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-283s21c1
Sequence:CCGGCACATGGCTATTCACTATAATCTCGAGATTATAGTGAATAGCCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416176    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178914.3-1911s21c1
Sequence:CCGGTGTGGCCAGTAACTCAATATTCTCGAGAATATTGAGTTACTGGCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178914.3-1593s21c1
Sequence:CCGGGCATTCAGAGGGTGTTATAATCTCGAGATTATAACACCCTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018418
VALIDATED
SPATA7 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-1392s1c1
Sequence:CCGGCATGTCCTGAAAGTAGACTTACTCGAGTAAGTCTACTTTCAGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018418.1-405s1c1
Sequence:CCGGCAACGAAGAGAGAAACTCAAACTCGAGTTTGAGTTTCTCTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018418.1-1391s1c1
Sequence:CCGGGCATGTCCTGAAAGTAGACTTCTCGAGAAGTCTACTTTCAGGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-374s1c1
Sequence:CCGGCGTGAGTACCAGCATAAAGTACTCGAGTACTTTATGCTGGTACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018418.1-618s1c1
Sequence:CCGGGAGAGACTACACCTAAGTCTACTCGAGTAGACTTAGGTGTAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018418.1-595s1c1
Sequence:CCGGCAAGGTCACTAGTACCCTCTTCTCGAGAAGAGGGTACTAGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-1180s1c1
Sequence:CCGGCAAGGGCAATGTGTCAGTATTCTCGAGAATACTGACACATTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-465s21c1
Sequence:CCGGCTGCAATGCGAGCCAATTATACTCGAGTATAATTGGCTCGCATTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1861s21c1
Sequence:CCGGCAGTGTCAAAGGCGACAATAACTCGAGTTATTGTCGCCTTTGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1053s21c1
Sequence:CCGGACATAAAGCAGGCATCTAATTCTCGAGAATTAGATGCCTGCTTTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1584s21c1
Sequence:CCGGCAAAGGATGAGAACGAGATATCTCGAGATATCTCGTTCTCATCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1321s21c1
Sequence:CCGGACGACTGTTCGAGCGACATATCTCGAGATATGTCGCTCGAACAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018418
VALIDATED
SPATA7 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-1392s1c1
Sequence:CCGGCATGTCCTGAAAGTAGACTTACTCGAGTAAGTCTACTTTCAGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018418.1-405s1c1
Sequence:CCGGCAACGAAGAGAGAAACTCAAACTCGAGTTTGAGTTTCTCTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018418.1-1391s1c1
Sequence:CCGGGCATGTCCTGAAAGTAGACTTCTCGAGAAGTCTACTTTCAGGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-374s1c1
Sequence:CCGGCGTGAGTACCAGCATAAAGTACTCGAGTACTTTATGCTGGTACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018418.1-618s1c1
Sequence:CCGGGAGAGACTACACCTAAGTCTACTCGAGTAGACTTAGGTGTAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018418.1-595s1c1
Sequence:CCGGCAAGGTCACTAGTACCCTCTTCTCGAGAAGAGGGTACTAGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-1180s1c1
Sequence:CCGGCAAGGGCAATGTGTCAGTATTCTCGAGAATACTGACACATTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-465s21c1
Sequence:CCGGCTGCAATGCGAGCCAATTATACTCGAGTATAATTGGCTCGCATTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1861s21c1
Sequence:CCGGCAGTGTCAAAGGCGACAATAACTCGAGTTATTGTCGCCTTTGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1053s21c1
Sequence:CCGGACATAAAGCAGGCATCTAATTCTCGAGAATTAGATGCCTGCTTTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1584s21c1
Sequence:CCGGCAAAGGATGAGAACGAGATATCTCGAGATATCTCGTTCTCATCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1321s21c1
Sequence:CCGGACGACTGTTCGAGCGACATATCTCGAGATATGTCGCTCGAACAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018418
VALIDATED
SPATA7 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-1392s1c1
Sequence:CCGGCATGTCCTGAAAGTAGACTTACTCGAGTAAGTCTACTTTCAGGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018418.1-405s1c1
Sequence:CCGGCAACGAAGAGAGAAACTCAAACTCGAGTTTGAGTTTCTCTCTTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018418.1-1391s1c1
Sequence:CCGGGCATGTCCTGAAAGTAGACTTCTCGAGAAGTCTACTTTCAGGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-374s1c1
Sequence:CCGGCGTGAGTACCAGCATAAAGTACTCGAGTACTTTATGCTGGTACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_018418.1-618s1c1
Sequence:CCGGGAGAGACTACACCTAAGTCTACTCGAGTAGACTTAGGTGTAGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018418.1-595s1c1
Sequence:CCGGCAAGGTCACTAGTACCCTCTTCTCGAGAAGAGGGTACTAGTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018418.1-1180s1c1
Sequence:CCGGCAAGGGCAATGTGTCAGTATTCTCGAGAATACTGACACATTGCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-465s21c1
Sequence:CCGGCTGCAATGCGAGCCAATTATACTCGAGTATAATTGGCTCGCATTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1861s21c1
Sequence:CCGGCAGTGTCAAAGGCGACAATAACTCGAGTTATTGTCGCCTTTGACACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1053s21c1
Sequence:CCGGACATAAAGCAGGCATCTAATTCTCGAGAATTAGATGCCTGCTTTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1584s21c1
Sequence:CCGGCAAAGGATGAGAACGAGATATCTCGAGATATCTCGTTCTCATCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018418.3-1321s21c1
Sequence:CCGGACGACTGTTCGAGCGACATATCTCGAGATATGTCGCTCGAACAGTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks