EMAIL THIS PAGE TO A FRIEND

SPATA8

spermatogenesis associated 8

Synonyms: SRG8
Species: Human SPATA8(145946)
UniProtKB ID: Q6RVD6, Q2KJ07
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173499 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008221 MISSION® esiRNA esiRNA targeting human SPATA8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173499 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157131 predicted 505
2 SASI_Hs01_00157132 predicted 506
3 SASI_Hs01_00157133 predicted 656
4 SASI_Hs01_00157134 predicted 647
5 SASI_Hs01_00157135 predicted 482
6 SASI_Hs01_00157136 predicted 638
7 SASI_Hs01_00157137 predicted 566
8 SASI_Hs01_00157139 predicted 648
9 SASI_Hs01_00157140 predicted 643
10 SASI_Hs02_00368268 predicted 553
11 SASI_Hs01_00157138 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173499
SPATA8 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173499.3-781s21c1
Sequence:CCGGTAGTCCTGGAATGGTGTATTCCTCGAGGAATACACCATTCCAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173499.3-754s21c1
Sequence:CCGGCATCCTCAGCAGCCTAGTATGCTCGAGCATACTAGGCTGCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173499.1-815s1c1
Sequence:CCGGGCCTTTCGTTTCCCTATTCAACTCGAGTTGAATAGGGAAACGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-478s1c1
Sequence:CCGGGTGTCCTGTTTCACCCATATTCTCGAGAATATGGGTGAAACAGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-449s1c1
Sequence:CCGGCCCACTGATTCAGAAGATAAACTCGAGTTTATCTTCTGAATCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-290s1c1
Sequence:CCGGGCGACATTTCTCAGAAGCCATCTCGAGATGGCTTCTGAGAAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-218s1c1
Sequence:CCGGCCAGGACAACTCCTGTCTCTACTCGAGTAGAGACAGGAGTTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173499
SPATA8 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173499.3-781s21c1
Sequence:CCGGTAGTCCTGGAATGGTGTATTCCTCGAGGAATACACCATTCCAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173499.3-754s21c1
Sequence:CCGGCATCCTCAGCAGCCTAGTATGCTCGAGCATACTAGGCTGCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173499.1-815s1c1
Sequence:CCGGGCCTTTCGTTTCCCTATTCAACTCGAGTTGAATAGGGAAACGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-478s1c1
Sequence:CCGGGTGTCCTGTTTCACCCATATTCTCGAGAATATGGGTGAAACAGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-449s1c1
Sequence:CCGGCCCACTGATTCAGAAGATAAACTCGAGTTTATCTTCTGAATCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-290s1c1
Sequence:CCGGGCGACATTTCTCAGAAGCCATCTCGAGATGGCTTCTGAGAAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-218s1c1
Sequence:CCGGCCAGGACAACTCCTGTCTCTACTCGAGTAGAGACAGGAGTTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173499
SPATA8 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173499.3-781s21c1
Sequence:CCGGTAGTCCTGGAATGGTGTATTCCTCGAGGAATACACCATTCCAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173499.3-754s21c1
Sequence:CCGGCATCCTCAGCAGCCTAGTATGCTCGAGCATACTAGGCTGCTGAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005101    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173499.1-815s1c1
Sequence:CCGGGCCTTTCGTTTCCCTATTCAACTCGAGTTGAATAGGGAAACGAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-478s1c1
Sequence:CCGGGTGTCCTGTTTCACCCATATTCTCGAGAATATGGGTGAAACAGGACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-449s1c1
Sequence:CCGGCCCACTGATTCAGAAGATAAACTCGAGTTTATCTTCTGAATCAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-290s1c1
Sequence:CCGGGCGACATTTCTCAGAAGCCATCTCGAGATGGCTTCTGAGAAATGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173499.1-218s1c1
Sequence:CCGGCCAGGACAACTCCTGTCTCTACTCGAGTAGAGACAGGAGTTGTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks