EMAIL THIS PAGE TO A FRIEND

SPATA9

spermatogenesis associated 9

Synonyms: NYD-SP16
UniProtKB ID: Q9BWV2, A8K8H3, Q4G122, Q86X33, Q8NA28
Gene ID:
Mouse(75571) spermatogenesis associated 9
Rat(294594) spermatogenesis associated 9
dog(609289) spermatogenesis associated 9
domestic cat(101081606) spermatogenesis associated 9
cow(613406) spermatogenesis associated 9
sheep(101109613) spermatogenesis associated 9
domestic guinea pig(100715373) spermatogenesis associated 9
naked mole-rat(101700612) spermatogenesis associated 9
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031952 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031952 Rosetta Predictions human pricing
NM_173360 Rosetta Predictions human pricing
NM_001106399 Rosetta Predictions rat pricing
NM_029343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097094 predicted 577
2 SASI_Hs02_00359117 predicted 751
3 SASI_Hs01_00097095 predicted 354
4 SASI_Hs01_00097097 predicted 594
5 SASI_Hs02_00359118 predicted 370
6 SASI_Hs01_00097100 predicted 405
7 SASI_Hs01_00097103 predicted 405
8 SASI_Hs02_00359119 predicted 789
9 SASI_Hs02_00359120 predicted 616
10 SASI_Hs02_00359121 predicted 796
11 SASI_Hs01_00097096 predicted 676
12 SASI_Hs01_00097098 predicted 478
13 SASI_Hs01_00097099 predicted 488
14 SASI_Hs01_00097101 predicted 535
15 SASI_Hs01_00097102 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186442 predicted 578
2 SASI_Hs01_00186443 predicted 364
3 SASI_Hs01_00186444 predicted 679
4 SASI_Hs01_00186445 predicted 606
5 SASI_Hs01_00186446 predicted 487
6 SASI_Hs01_00186447 predicted 489
7 SASI_Hs01_00186448 predicted 413
8 SASI_Hs01_00186449 predicted 541
9 SASI_Hs01_00186450 predicted 425
10 SASI_Hs01_00186451 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218578 predicted 806
2 SASI_Rn02_00218579 predicted 544
3 SASI_Rn02_00218580 predicted 547
4 SASI_Rn02_00218581 predicted 543
5 SASI_Rn02_00218582 predicted 611
6 SASI_Rn02_00218583 predicted 805
7 SASI_Rn02_00218584 predicted 799
8 SASI_Rn02_00218585 predicted 557
9 SASI_Rn02_00218586 predicted 799
10 SASI_Rn02_00218587 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067913 predicted 813
2 SASI_Mm01_00067914 predicted 521
3 SASI_Mm01_00067915 predicted 538
4 SASI_Mm01_00067917 predicted 270
5 SASI_Mm01_00067918 predicted 209
6 SASI_Mm01_00067919 predicted 821
7 SASI_Mm01_00067920 predicted 772
8 SASI_Mm02_00335180 predicted 195
9 SASI_Mm01_00067921 predicted 555
10 SASI_Mm02_00335181 predicted 347
11 SASI_Mm01_00067916 predicted 394
12 SASI_Mm01_00067922 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031952
SPATA9 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-759s1c1
Sequence:CCGGGAAGCCAGACATTTCAGATTACTCGAGTAATCTGAAATGTCTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-834s1c1
Sequence:CCGGGTTTGACCAATCAGCTGAAATCTCGAGATTTCAGCTGATTGGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-845s1c1
Sequence:CCGGCAGCTGAAATGAATGAGCAAACTCGAGTTTGCTCATTCATTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-801s1c1
Sequence:CCGGGCAGAGTAATAACATCCAAGTCTCGAGACTTGGATGTTATTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-600s1c1
Sequence:CCGGGCTGAAGAAGGTAAAGAACATCTCGAGATGTTCTTTACCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-184s1c1
Sequence:CCGGGCAATCATGGACCTTGTAGATCTCGAGATCTACAAGGTCCATGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-178s1c1
Sequence:CCGGCAGAAAGCAATCATGGACCTTCTCGAGAAGGTCCATGATTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-223s1c1
Sequence:CCGGCCCACCATCCTAAGATTATCACTCGAGTGATAATCTTAGGATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-388s1c1
Sequence:CCGGCCTCAGCTTACATGCAGACTTCTCGAGAAGTCTGCATGTAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-628s1c1
Sequence:CCGGGAAGAAGAATCCATAAGGCAACTCGAGTTGCCTTATGGATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031952
SPATA9 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-759s1c1
Sequence:CCGGGAAGCCAGACATTTCAGATTACTCGAGTAATCTGAAATGTCTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-834s1c1
Sequence:CCGGGTTTGACCAATCAGCTGAAATCTCGAGATTTCAGCTGATTGGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-845s1c1
Sequence:CCGGCAGCTGAAATGAATGAGCAAACTCGAGTTTGCTCATTCATTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-801s1c1
Sequence:CCGGGCAGAGTAATAACATCCAAGTCTCGAGACTTGGATGTTATTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-600s1c1
Sequence:CCGGGCTGAAGAAGGTAAAGAACATCTCGAGATGTTCTTTACCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-184s1c1
Sequence:CCGGGCAATCATGGACCTTGTAGATCTCGAGATCTACAAGGTCCATGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-178s1c1
Sequence:CCGGCAGAAAGCAATCATGGACCTTCTCGAGAAGGTCCATGATTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-223s1c1
Sequence:CCGGCCCACCATCCTAAGATTATCACTCGAGTGATAATCTTAGGATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-388s1c1
Sequence:CCGGCCTCAGCTTACATGCAGACTTCTCGAGAAGTCTGCATGTAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-628s1c1
Sequence:CCGGGAAGAAGAATCCATAAGGCAACTCGAGTTGCCTTATGGATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031952
SPATA9 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-759s1c1
Sequence:CCGGGAAGCCAGACATTTCAGATTACTCGAGTAATCTGAAATGTCTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-834s1c1
Sequence:CCGGGTTTGACCAATCAGCTGAAATCTCGAGATTTCAGCTGATTGGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-845s1c1
Sequence:CCGGCAGCTGAAATGAATGAGCAAACTCGAGTTTGCTCATTCATTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144594    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-801s1c1
Sequence:CCGGGCAGAGTAATAACATCCAAGTCTCGAGACTTGGATGTTATTACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-600s1c1
Sequence:CCGGGCTGAAGAAGGTAAAGAACATCTCGAGATGTTCTTTACCTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-184s1c1
Sequence:CCGGGCAATCATGGACCTTGTAGATCTCGAGATCTACAAGGTCCATGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-178s1c1
Sequence:CCGGCAGAAAGCAATCATGGACCTTCTCGAGAAGGTCCATGATTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031952.1-223s1c1
Sequence:CCGGCCCACCATCCTAAGATTATCACTCGAGTGATAATCTTAGGATGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-388s1c1
Sequence:CCGGCCTCAGCTTACATGCAGACTTCTCGAGAAGTCTGCATGTAAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031952.1-628s1c1
Sequence:CCGGGAAGAAGAATCCATAAGGCAACTCGAGTTGCCTTATGGATTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029343
SPATA9 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029343.1-882s1c1
Sequence:CCGGGAGTGCTCAATAGTTATCTATCTCGAGATAGATAACTATTGAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029343.1-436s1c1
Sequence:CCGGGAAGTGAATGTGGCGAGTCAACTCGAGTTGACTCGCCACATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-172s21c1
Sequence:CCGGAGGCAATCATGGACCTTATTGCTCGAGCAATAAGGTCCATGATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-313s21c1
Sequence:CCGGGGACGCTCATTCAAGGGTTAACTCGAGTTAACCCTTGAATGAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029343.3-860s21c1
Sequence:CCGGACAAACACAAATACCACTTTACTCGAGTAAAGTGGTATTTGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-583s21c1
Sequence:CCGGATGCGGTGCTGGCAAAGATAACTCGAGTTATCTTTGCCAGCACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-545s21c1
Sequence:CCGGTTCTTATGCAGCACTAATTTACTCGAGTAAATTAGTGCTGCATAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029343
SPATA9 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029343.1-882s1c1
Sequence:CCGGGAGTGCTCAATAGTTATCTATCTCGAGATAGATAACTATTGAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029343.1-436s1c1
Sequence:CCGGGAAGTGAATGTGGCGAGTCAACTCGAGTTGACTCGCCACATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-172s21c1
Sequence:CCGGAGGCAATCATGGACCTTATTGCTCGAGCAATAAGGTCCATGATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-313s21c1
Sequence:CCGGGGACGCTCATTCAAGGGTTAACTCGAGTTAACCCTTGAATGAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029343.3-860s21c1
Sequence:CCGGACAAACACAAATACCACTTTACTCGAGTAAAGTGGTATTTGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-583s21c1
Sequence:CCGGATGCGGTGCTGGCAAAGATAACTCGAGTTATCTTTGCCAGCACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-545s21c1
Sequence:CCGGTTCTTATGCAGCACTAATTTACTCGAGTAAATTAGTGCTGCATAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029343
SPATA9 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029343.1-882s1c1
Sequence:CCGGGAGTGCTCAATAGTTATCTATCTCGAGATAGATAACTATTGAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029343.1-436s1c1
Sequence:CCGGGAAGTGAATGTGGCGAGTCAACTCGAGTTGACTCGCCACATTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-172s21c1
Sequence:CCGGAGGCAATCATGGACCTTATTGCTCGAGCAATAAGGTCCATGATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-313s21c1
Sequence:CCGGGGACGCTCATTCAAGGGTTAACTCGAGTTAACCCTTGAATGAGCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029343.3-860s21c1
Sequence:CCGGACAAACACAAATACCACTTTACTCGAGTAAAGTGGTATTTGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-583s21c1
Sequence:CCGGATGCGGTGCTGGCAAAGATAACTCGAGTTATCTTTGCCAGCACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029343.3-545s21c1
Sequence:CCGGTTCTTATGCAGCACTAATTTACTCGAGTAAATTAGTGCTGCATAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks