EMAIL THIS PAGE TO A FRIEND

SPATC1

spermatogenesis and centriole associated 1

Synonyms: SPATA15
UniProtKB ID: Q76KD6, B4DWW9, Q5U5I8, Q7Z6L7
Gene ID:
Mouse(74281) spermatogenesis and centriole associated 1
Rat(315091) spermatogenesis and centriole associated 1
naked mole-rat(101709209) spermatogenesis and centriole associated 1
domestic guinea pig(100732451) spermatogenesis and centriole associated 1
cow(618305) spermatogenesis and centriole associated 1
sheep(101114366) spermatogenesis and centriole associated 1
dog(475119) spermatogenesis and centriole associated 1
domestic cat(101100366) spermatogenesis and centriole associated 1
Horse(100065351) spermatogenesis and centriole associated 1
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198572 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014051 MISSION® esiRNA esiRNA targeting human SPATC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198572 Rosetta Predictions human pricing
NM_001115026 Rosetta Predictions rat pricing
NM_028852 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152453 predicted 1584
2 SASI_Hs01_00152454 predicted 1302
3 SASI_Hs01_00152455 predicted 360
4 SASI_Hs02_00372206 predicted 1307
5 SASI_Hs01_00152457 predicted 1538
6 SASI_Hs02_00372207 predicted 1573
7 SASI_Hs01_00152458 predicted 1649
8 SASI_Hs01_00152459 predicted 1591
9 SASI_Hs01_00152460 predicted 727
10 SASI_Hs01_00152461 predicted 1478
11 SASI_Hs01_00152456 predicted 1438
12 SASI_Hs01_00152462 predicted 1340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252433 predicted 437
2 SASI_Rn02_00252434 predicted 1230
3 SASI_Rn02_00252435 predicted 781
4 SASI_Rn02_00252436 predicted 1012
5 SASI_Rn02_00252437 predicted 414
6 SASI_Rn02_00252438 predicted 674
7 SASI_Rn02_00252439 predicted 1087
8 SASI_Rn02_00252440 predicted 501
9 SASI_Rn02_00252441 predicted 1310
10 SASI_Rn02_00252442 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028852 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197180 predicted 1257
2 SASI_Mm01_00197181 predicted 770
3 SASI_Mm01_00197182 predicted 1140
4 SASI_Mm01_00197183 predicted 354
5 SASI_Mm01_00197184 predicted 1311
6 SASI_Mm01_00197185 predicted 508
7 SASI_Mm02_00334513 predicted 640
8 SASI_Mm01_00197186 predicted 878
9 SASI_Mm01_00197188 predicted 1108
10 SASI_Mm01_00197189 predicted 798
11 SASI_Mm01_00197187 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198572
SPATC1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and centriole associated 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-1607s21c1
Sequence:CCGGAGCGCTATGTGAGCGTCATGACTCGAGTCATGACGCTCACATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-176s21c1
Sequence:CCGGAGAAGTTGGTGCGGCTCATTCCTCGAGGAATGAGCCGCACCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-1678s21c1
Sequence:CCGGGAGCAGCTGGTGAACGCTTATCTCGAGATAAGCGTTCACCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-293s21c1
Sequence:CCGGTTTCCTCACGCCAGAACAATGCTCGAGCATTGTTCTGGCGTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1496s1c1
Sequence:CCGGCTCCAACATCCCAGAGAAGATCTCGAGATCTTCTCTGGGATGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1507s1c1
Sequence:CCGGCAGAGAAGATCATCCAGGCTTCTCGAGAAGCCTGGATGATCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1169s1c1
Sequence:CCGGCCCTTCCCGAATGCATAATTCCTCGAGGAATTATGCATTCGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198572
SPATC1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis and centriole associated 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-1607s21c1
Sequence:CCGGAGCGCTATGTGAGCGTCATGACTCGAGTCATGACGCTCACATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-176s21c1
Sequence:CCGGAGAAGTTGGTGCGGCTCATTCCTCGAGGAATGAGCCGCACCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-1678s21c1
Sequence:CCGGGAGCAGCTGGTGAACGCTTATCTCGAGATAAGCGTTCACCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-293s21c1
Sequence:CCGGTTTCCTCACGCCAGAACAATGCTCGAGCATTGTTCTGGCGTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1496s1c1
Sequence:CCGGCTCCAACATCCCAGAGAAGATCTCGAGATCTTCTCTGGGATGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1507s1c1
Sequence:CCGGCAGAGAAGATCATCCAGGCTTCTCGAGAAGCCTGGATGATCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1169s1c1
Sequence:CCGGCCCTTCCCGAATGCATAATTCCTCGAGGAATTATGCATTCGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198572
SPATC1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and centriole associated 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-1607s21c1
Sequence:CCGGAGCGCTATGTGAGCGTCATGACTCGAGTCATGACGCTCACATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-176s21c1
Sequence:CCGGAGAAGTTGGTGCGGCTCATTCCTCGAGGAATGAGCCGCACCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-1678s21c1
Sequence:CCGGGAGCAGCTGGTGAACGCTTATCTCGAGATAAGCGTTCACCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198572.2-293s21c1
Sequence:CCGGTTTCCTCACGCCAGAACAATGCTCGAGCATTGTTCTGGCGTGAGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181048    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1496s1c1
Sequence:CCGGCTCCAACATCCCAGAGAAGATCTCGAGATCTTCTCTGGGATGTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1507s1c1
Sequence:CCGGCAGAGAAGATCATCCAGGCTTCTCGAGAAGCCTGGATGATCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198572.1-1169s1c1
Sequence:CCGGCCCTTCCCGAATGCATAATTCCTCGAGGAATTATGCATTCGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028852
SPATC1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and centriole associated 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-452s1c1
Sequence:CCGGGTCTGGCCAAATACCCTTGTTCTCGAGAACAAGGGTATTTGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-514s1c1
Sequence:CCGGGCAACCAACTGACCAATCCTACTCGAGTAGGATTGGTCAGTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-971s1c1
Sequence:CCGGGATGGAACAGTCTCGGAAGAACTCGAGTTCTTCCGAGACTGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-599s1c1
Sequence:CCGGCAGTCAAATGACTAGTCCCATCTCGAGATGGGACTAGTCATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028852
SPATC1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis and centriole associated 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-452s1c1
Sequence:CCGGGTCTGGCCAAATACCCTTGTTCTCGAGAACAAGGGTATTTGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-514s1c1
Sequence:CCGGGCAACCAACTGACCAATCCTACTCGAGTAGGATTGGTCAGTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-971s1c1
Sequence:CCGGGATGGAACAGTCTCGGAAGAACTCGAGTTCTTCCGAGACTGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-599s1c1
Sequence:CCGGCAGTCAAATGACTAGTCCCATCTCGAGATGGGACTAGTCATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028852
SPATC1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and centriole associated 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-452s1c1
Sequence:CCGGGTCTGGCCAAATACCCTTGTTCTCGAGAACAAGGGTATTTGGCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-514s1c1
Sequence:CCGGGCAACCAACTGACCAATCCTACTCGAGTAGGATTGGTCAGTTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-971s1c1
Sequence:CCGGGATGGAACAGTCTCGGAAGAACTCGAGTTCTTCCGAGACTGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028852.1-599s1c1
Sequence:CCGGCAGTCAAATGACTAGTCCCATCTCGAGATGGGACTAGTCATTTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks