EMAIL THIS PAGE TO A FRIEND

SPATC1L

spermatogenesis and centriole associated 1-like

Synonyms: C21orf56
UniProtKB ID: Q9H0A9, B4E323, Q52LS9, Q6FIH5, Q6P0L3, Q9NSE5
Gene ID:
Mouse(76573) spermatogenesis and centriole associated 1 like
Rat(499418) spermatogenesis and centriole associated 1-like
dog(607689) spermatogenesis and centriole associated 1-like
cow(522100) spermatogenesis and centriole associated 1-like
sheep(101112184) spermatogenesis and centriole associated 1-like
domestic guinea pig(100728486) spermatogenesis and centriole associated 1-like
naked mole-rat(101713550) spermatogenesis and centriole associated 1-like
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032261 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151321 MISSION® esiRNA esiRNA human C21orf56 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032261 Rosetta Predictions human pricing
NM_001024296 Rosetta Predictions rat pricing
NM_029661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105335 predicted 522
2 SASI_Hs01_00105337 predicted 654
3 SASI_Hs01_00105338 predicted 363
4 SASI_Hs01_00105339 predicted 662
5 SASI_Hs01_00105340 predicted 652
6 SASI_Hs01_00105341 predicted 367
7 SASI_Hs02_00359568 predicted 312
8 SASI_Hs01_00105342 predicted 361
9 SASI_Hs02_00359569 predicted 489
10 SASI_Hs02_00359570 predicted 427
11 SASI_Hs01_00105336 predicted 305
12 SASI_Hs01_00105343 predicted 308
13 SASI_Hs01_00105344 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105299 predicted 848
2 SASI_Rn01_00105300 predicted 568
3 SASI_Rn01_00105301 predicted 984
4 SASI_Rn01_00105302 predicted 366
5 SASI_Rn01_00105303 predicted 654
6 SASI_Rn01_00105304 predicted 684
7 SASI_Rn02_00202487 predicted 706
8 SASI_Rn01_00105305 predicted 413
9 SASI_Rn01_00105306 predicted 737
10 SASI_Rn02_00202488 predicted 679
11 SASI_Rn01_00105297 predicted 499
12 SASI_Rn01_00105298 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024186 predicted 907
2 SASI_Mm01_00024187 predicted 628
3 SASI_Mm01_00024188 predicted 424
4 SASI_Mm01_00024189 predicted 284
5 SASI_Mm01_00024191 predicted 1047
6 SASI_Mm01_00024192 predicted 914
7 SASI_Mm01_00024193 predicted 1065
8 SASI_Mm01_00024194 predicted 348
9 SASI_Mm01_00024195 predicted 1006
10 SASI_Mm02_00335686 predicted 1003
11 SASI_Mm01_00024190 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029661
SPATC1L MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and centriole associated 1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029661.1-1138s1c1
Sequence:CCGGCCTTCCGGCAATAAACGTGTTCTCGAGAACACGTTTATTGCCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029661.1-759s1c1
Sequence:CCGGGTTTCACAGTGTCCAACATTCCTCGAGGAATGTTGGACACTGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-617s21c1
Sequence:CCGGAGGAGCAGGAGGACCTATTACCTCGAGGTAATAGGTCCTCCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-355s21c1
Sequence:CCGGCTCTCTGGAGGACCTACTATGCTCGAGCATAGTAGGTCCTCCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-286s21c1
Sequence:CCGGAGGGAATGGAGGTCCAGATTTCTCGAGAAATCTGGACCTCCATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029661.1-1132s21c1
Sequence:CCGGCCTCACCCTTCCGGCAATAAACTCGAGTTTATTGCCGGAAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-581s21c1
Sequence:CCGGGTGTGCTTCTCGGAGAGTAACCTCGAGGTTACTCTCCGAGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029661
SPATC1L MISSION shRNA shRNA Plasmid DNA
spermatogenesis and centriole associated 1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029661.1-1138s1c1
Sequence:CCGGCCTTCCGGCAATAAACGTGTTCTCGAGAACACGTTTATTGCCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029661.1-759s1c1
Sequence:CCGGGTTTCACAGTGTCCAACATTCCTCGAGGAATGTTGGACACTGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-617s21c1
Sequence:CCGGAGGAGCAGGAGGACCTATTACCTCGAGGTAATAGGTCCTCCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-355s21c1
Sequence:CCGGCTCTCTGGAGGACCTACTATGCTCGAGCATAGTAGGTCCTCCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-286s21c1
Sequence:CCGGAGGGAATGGAGGTCCAGATTTCTCGAGAAATCTGGACCTCCATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029661.1-1132s21c1
Sequence:CCGGCCTCACCCTTCCGGCAATAAACTCGAGTTTATTGCCGGAAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-581s21c1
Sequence:CCGGGTGTGCTTCTCGGAGAGTAACCTCGAGGTTACTCTCCGAGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029661
SPATC1L MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and centriole associated 1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029661.1-1138s1c1
Sequence:CCGGCCTTCCGGCAATAAACGTGTTCTCGAGAACACGTTTATTGCCGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029661.1-759s1c1
Sequence:CCGGGTTTCACAGTGTCCAACATTCCTCGAGGAATGTTGGACACTGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-617s21c1
Sequence:CCGGAGGAGCAGGAGGACCTATTACCTCGAGGTAATAGGTCCTCCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-355s21c1
Sequence:CCGGCTCTCTGGAGGACCTACTATGCTCGAGCATAGTAGGTCCTCCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-286s21c1
Sequence:CCGGAGGGAATGGAGGTCCAGATTTCTCGAGAAATCTGGACCTCCATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029661.1-1132s21c1
Sequence:CCGGCCTCACCCTTCCGGCAATAAACTCGAGTTTATTGCCGGAAGGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029661.1-581s21c1
Sequence:CCGGGTGTGCTTCTCGGAGAGTAACCTCGAGGTTACTCTCCGAGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032261
VALIDATED
SPATC1L MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and centriole associated 1-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-664s1c1
Sequence:CCGGCGAGTTCCTCATCAACACCTACTCGAGTAGGTGTTGATGAGGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032261.3-377s1c1
Sequence:CCGGCTCAATGAGATCCAGAGCTTCCTCGAGGAAGCTCTGGATCTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032261.3-673s1c1
Sequence:CCGGCATCAACACCTACGGAATCCTCTCGAGAGGATTCCGTAGGTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-367s1c1
Sequence:CCGGGAGCTACTACCTCAATGAGATCTCGAGATCTCATTGAGGTAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-658s1c1
Sequence:CCGGGTTCAGCGAGTTCCTCATCAACTCGAGTTGATGAGGAACTCGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-671s1c1
Sequence:CCGGCTCATCAACACCTACGGAATCCTCGAGGATTCCGTAGGTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-676s1c1
Sequence:CCGGCAACACCTACGGAATCCTGAACTCGAGTTCAGGATTCCGTAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032261.4-956s21c1
Sequence:CCGGTGCCTGCAGTAAACGCGTTTGCTCGAGCAAACGCGTTTACTGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-864s21c1
Sequence:CCGGACTCGCTGCTGCTGCTCAACTCTCGAGAGTTGAGCAGCAGCAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-428s21c1
Sequence:CCGGAGGACCAGGAGGAGCTACTACCTCGAGGTAGTAGCTCCTCCTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-603s21c1
Sequence:CCGGAGCAGACCTCCACCAAGTCTCCTCGAGGAGACTTGGTGGAGGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032261
VALIDATED
SPATC1L MISSION shRNA shRNA Plasmid DNA
spermatogenesis and centriole associated 1-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-664s1c1
Sequence:CCGGCGAGTTCCTCATCAACACCTACTCGAGTAGGTGTTGATGAGGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032261.3-377s1c1
Sequence:CCGGCTCAATGAGATCCAGAGCTTCCTCGAGGAAGCTCTGGATCTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032261.3-673s1c1
Sequence:CCGGCATCAACACCTACGGAATCCTCTCGAGAGGATTCCGTAGGTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-367s1c1
Sequence:CCGGGAGCTACTACCTCAATGAGATCTCGAGATCTCATTGAGGTAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-658s1c1
Sequence:CCGGGTTCAGCGAGTTCCTCATCAACTCGAGTTGATGAGGAACTCGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-671s1c1
Sequence:CCGGCTCATCAACACCTACGGAATCCTCGAGGATTCCGTAGGTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-676s1c1
Sequence:CCGGCAACACCTACGGAATCCTGAACTCGAGTTCAGGATTCCGTAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032261.4-956s21c1
Sequence:CCGGTGCCTGCAGTAAACGCGTTTGCTCGAGCAAACGCGTTTACTGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-864s21c1
Sequence:CCGGACTCGCTGCTGCTGCTCAACTCTCGAGAGTTGAGCAGCAGCAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-428s21c1
Sequence:CCGGAGGACCAGGAGGAGCTACTACCTCGAGGTAGTAGCTCCTCCTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-603s21c1
Sequence:CCGGAGCAGACCTCCACCAAGTCTCCTCGAGGAGACTTGGTGGAGGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032261
VALIDATED
SPATC1L MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and centriole associated 1-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-664s1c1
Sequence:CCGGCGAGTTCCTCATCAACACCTACTCGAGTAGGTGTTGATGAGGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032261.3-377s1c1
Sequence:CCGGCTCAATGAGATCCAGAGCTTCCTCGAGGAAGCTCTGGATCTCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032261.3-673s1c1
Sequence:CCGGCATCAACACCTACGGAATCCTCTCGAGAGGATTCCGTAGGTGTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-367s1c1
Sequence:CCGGGAGCTACTACCTCAATGAGATCTCGAGATCTCATTGAGGTAGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-658s1c1
Sequence:CCGGGTTCAGCGAGTTCCTCATCAACTCGAGTTGATGAGGAACTCGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-671s1c1
Sequence:CCGGCTCATCAACACCTACGGAATCCTCGAGGATTCCGTAGGTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_032261.3-676s1c1
Sequence:CCGGCAACACCTACGGAATCCTGAACTCGAGTTCAGGATTCCGTAGGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032261.4-956s21c1
Sequence:CCGGTGCCTGCAGTAAACGCGTTTGCTCGAGCAAACGCGTTTACTGCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-864s21c1
Sequence:CCGGACTCGCTGCTGCTGCTCAACTCTCGAGAGTTGAGCAGCAGCAGCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-428s21c1
Sequence:CCGGAGGACCAGGAGGAGCTACTACCTCGAGGTAGTAGCTCCTCCTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032261.4-603s21c1
Sequence:CCGGAGCAGACCTCCACCAAGTCTCCTCGAGGAGACTTGGTGGAGGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks