EMAIL THIS PAGE TO A FRIEND

SPATS1

spermatogenesis associated, serine-rich 1

Synonyms: DDIP SPATA8 SRSP1
UniProtKB ID: Q496A3, Q496A2, Q496A5, Q96LJ0
Gene ID:
Mouse(71020) spermatogenesis associated, serine-rich 1
Rat(301255) spermatogenesis associated, serine-rich 1
naked mole-rat(101702062) spermatogenesis associated, serine-rich 1
domestic guinea pig(100735207) spermatogenesis associated, serine-rich 1
cow(511533) spermatogenesis associated, serine-rich 1
sheep(101114984) spermatogenesis associated, serine-rich 1
dog(609683) spermatogenesis associated, serine-rich 1
domestic cat(101098302) spermatogenesis associated, serine-rich 1
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145026 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145026 Rosetta Predictions human pricing
NM_181376 Rosetta Predictions rat pricing
NM_027649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364887 predicted 708
2 SASI_Hs01_00072915 predicted 731
3 SASI_Hs01_00072916 predicted 675
4 SASI_Hs01_00072917 predicted 523
5 SASI_Hs02_00364888 predicted 483
6 SASI_Hs01_00072918 predicted 787
7 SASI_Hs01_00072920 predicted 843
8 SASI_Hs02_00364889 predicted 679
9 SASI_Hs01_00072921 predicted 1012
10 SASI_Hs01_00072923 predicted 855
11 SASI_Hs01_00072919 predicted 827
12 SASI_Hs01_00072922 predicted 913
13 SASI_Hs01_00072924 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093809 predicted 930
2 SASI_Rn02_00269709 predicted 631
3 SASI_Rn01_00093810 predicted 661
4 SASI_Rn02_00269710 predicted 898
5 SASI_Rn01_00093811 predicted 862
6 SASI_Rn01_00093813 predicted 550
7 SASI_Rn01_00093815 predicted 728
8 SASI_Rn01_00093816 predicted 638
9 SASI_Rn01_00093817 predicted 597
10 SASI_Rn01_00093818 predicted 881
11 SASI_Rn01_00093812 predicted 629
12 SASI_Rn01_00093814 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159467 predicted 214
2 SASI_Mm01_00159468 predicted 664
3 SASI_Mm01_00159469 predicted 759
4 SASI_Mm01_00159470 predicted 219
5 SASI_Mm01_00159471 predicted 662
6 SASI_Mm01_00159472 predicted 698
7 SASI_Mm01_00159473 predicted 230
8 SASI_Mm01_00159474 predicted 692
9 SASI_Mm01_00159476 predicted 412
10 SASI_Mm02_00332528 predicted 893
11 SASI_Mm01_00159475 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027649
SPATS1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated, serine-rich 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-590s21c1
Sequence:CCGGGGGAAGAAGAAATACGATATTCTCGAGAATATCGTATTTCTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-820s21c1
Sequence:CCGGCAATTTGAAGAACGAGATAAACTCGAGTTTATCTCGTTCTTCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-452s21c1
Sequence:CCGGCAGCGTCCTGAGTGGACATTTCTCGAGAAATGTCCACTCAGGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.3-820s1c1
Sequence:CCGGCAATTTGAAGAACGAGATAAACTCGAGTTTATCTCGTTCTTCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.3-152s1c1
Sequence:CCGGGGTGATGCTCTAGAATCTAAACTCGAGTTTAGATTCTAGAGCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-492s21c1
Sequence:CCGGACATCCACACCTACCACATTGCTCGAGCAATGTGGTAGGTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-152s21c1
Sequence:CCGGGGTGATGCTCTAGAATCTAAACTCGAGTTTAGATTCTAGAGCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.1-590s1c1
Sequence:CCGGCGGGAAGAAGAAATACGATATCTCGAGATATCGTATTTCTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027649
SPATS1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated, serine-rich 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-590s21c1
Sequence:CCGGGGGAAGAAGAAATACGATATTCTCGAGAATATCGTATTTCTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-820s21c1
Sequence:CCGGCAATTTGAAGAACGAGATAAACTCGAGTTTATCTCGTTCTTCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-452s21c1
Sequence:CCGGCAGCGTCCTGAGTGGACATTTCTCGAGAAATGTCCACTCAGGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.3-820s1c1
Sequence:CCGGCAATTTGAAGAACGAGATAAACTCGAGTTTATCTCGTTCTTCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.3-152s1c1
Sequence:CCGGGGTGATGCTCTAGAATCTAAACTCGAGTTTAGATTCTAGAGCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-492s21c1
Sequence:CCGGACATCCACACCTACCACATTGCTCGAGCAATGTGGTAGGTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-152s21c1
Sequence:CCGGGGTGATGCTCTAGAATCTAAACTCGAGTTTAGATTCTAGAGCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.1-590s1c1
Sequence:CCGGCGGGAAGAAGAAATACGATATCTCGAGATATCGTATTTCTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027649
SPATS1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated, serine-rich 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-590s21c1
Sequence:CCGGGGGAAGAAGAAATACGATATTCTCGAGAATATCGTATTTCTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-820s21c1
Sequence:CCGGCAATTTGAAGAACGAGATAAACTCGAGTTTATCTCGTTCTTCAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-452s21c1
Sequence:CCGGCAGCGTCCTGAGTGGACATTTCTCGAGAAATGTCCACTCAGGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.3-820s1c1
Sequence:CCGGCAATTTGAAGAACGAGATAAACTCGAGTTTATCTCGTTCTTCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.3-152s1c1
Sequence:CCGGGGTGATGCTCTAGAATCTAAACTCGAGTTTAGATTCTAGAGCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-492s21c1
Sequence:CCGGACATCCACACCTACCACATTGCTCGAGCAATGTGGTAGGTGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027649.3-152s21c1
Sequence:CCGGGGTGATGCTCTAGAATCTAAACTCGAGTTTAGATTCTAGAGCATCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027649.1-590s1c1
Sequence:CCGGCGGGAAGAAGAAATACGATATCTCGAGATATCGTATTTCTTCTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145026
SPATS1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated, serine-rich 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-654s1c1
Sequence:CCGGCGGAAACTCTCCTTCTCACATCTCGAGATGTGAGAAGGAGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-791s1c1
Sequence:CCGGCCCAAGGTTTAGCAGCAACATCTCGAGATGTTGCTGCTAAACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-660s1c1
Sequence:CCGGCTCTCCTTCTCACATTCTGATCTCGAGATCAGAATGTGAGAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-932s1c1
Sequence:CCGGCAGGAATGGAATCCCAAAGTTCTCGAGAACTTTGGGATTCCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-1125s1c1
Sequence:CCGGGAGAAGGCCAACAGTTTGAAACTCGAGTTTCAAACTGTTGGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145026
SPATS1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated, serine-rich 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-654s1c1
Sequence:CCGGCGGAAACTCTCCTTCTCACATCTCGAGATGTGAGAAGGAGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-791s1c1
Sequence:CCGGCCCAAGGTTTAGCAGCAACATCTCGAGATGTTGCTGCTAAACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-660s1c1
Sequence:CCGGCTCTCCTTCTCACATTCTGATCTCGAGATCAGAATGTGAGAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-932s1c1
Sequence:CCGGCAGGAATGGAATCCCAAAGTTCTCGAGAACTTTGGGATTCCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-1125s1c1
Sequence:CCGGGAGAAGGCCAACAGTTTGAAACTCGAGTTTCAAACTGTTGGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145026
SPATS1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated, serine-rich 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-654s1c1
Sequence:CCGGCGGAAACTCTCCTTCTCACATCTCGAGATGTGAGAAGGAGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-791s1c1
Sequence:CCGGCCCAAGGTTTAGCAGCAACATCTCGAGATGTTGCTGCTAAACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-660s1c1
Sequence:CCGGCTCTCCTTCTCACATTCTGATCTCGAGATCAGAATGTGAGAAGGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-932s1c1
Sequence:CCGGCAGGAATGGAATCCCAAAGTTCTCGAGAACTTTGGGATTCCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145026.2-1125s1c1
Sequence:CCGGGAGAAGGCCAACAGTTTGAAACTCGAGTTTCAAACTGTTGGCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks