EMAIL THIS PAGE TO A FRIEND

SPATS2

spermatogenesis associated, serine-rich 2

Synonyms: P59SCR SCR59 SPATA10
UniProtKB ID: Q86XZ4, A8K8G9, Q9H7D4, Q9H8Y7, Q9H8Z8
Gene ID:
Mouse(72572) spermatogenesis associated, serine-rich 2
Rat(300221) spermatogenesis associated, serine-rich 2
chicken(426663) spermatogenesis associated, serine-rich 2
Horse(100059513) spermatogenesis associated, serine-rich 2
domestic cat(101083014) spermatogenesis associated, serine-rich 2
dog(477617) spermatogenesis associated, serine-rich 2
cow(617860) spermatogenesis associated, serine-rich 2
sheep(101118688) spermatogenesis associated, serine-rich 2
domestic guinea pig(100725676) spermatogenesis associated, serine-rich 2
naked mole-rat(101707311) spermatogenesis associated, serine-rich 2
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023071 Rosetta Predictions human pricing
XM_001061947 Rosetta Predictions rat pricing
XM_001062003 Rosetta Predictions rat pricing
XM_217030 Rosetta Predictions rat pricing
NM_139140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173996 predicted 2311
2 SASI_Hs01_00173997 predicted 1563
3 SASI_Hs01_00173998 predicted 1680
4 SASI_Hs01_00173999 predicted 1820
5 SASI_Hs01_00174000 predicted 1990
6 SASI_Hs01_00174001 predicted 2392
7 SASI_Hs01_00174002 predicted 1810
8 SASI_Hs01_00174003 predicted 1587
9 SASI_Hs01_00174004 predicted 2440
10 SASI_Hs01_00174005 predicted 1936
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301860 predicted 1530
2 SASI_Rn02_00301861 predicted 1518
3 SASI_Rn02_00301862 predicted 2181
4 SASI_Rn02_00301863 predicted 1467
5 SASI_Rn02_00301864 predicted 976
6 SASI_Rn02_00301865 predicted 1450
7 SASI_Rn02_00301866 predicted 1251
8 SASI_Rn02_00301867 predicted 1258
9 SASI_Rn02_00301868 predicted 1437
10 SASI_Rn02_00301869 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302035 predicted 1528
2 SASI_Rn02_00302036 predicted 1519
3 SASI_Rn02_00302037 predicted 2216
4 SASI_Rn02_00302038 predicted 1472
5 SASI_Rn02_00302039 predicted 977
6 SASI_Rn02_00302040 predicted 1445
7 SASI_Rn02_00302041 predicted 1250
8 SASI_Rn02_00302042 predicted 1258
9 SASI_Rn02_00302043 predicted 1432
10 SASI_Rn02_00302044 predicted 1876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376970 predicted 1531
2 SASI_Rn02_00376971 predicted 1515
3 SASI_Rn02_00376972 predicted 2216
4 SASI_Rn02_00376973 predicted 1473
5 SASI_Rn02_00376974 predicted 974
6 SASI_Rn02_00376975 predicted 1452
7 SASI_Rn02_00376976 predicted 1248
8 SASI_Rn02_00376977 predicted 1266
9 SASI_Rn02_00376978 predicted 1432
10 SASI_Rn02_00376979 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191942 predicted 1400
2 SASI_Mm01_00191943 predicted 1774
3 SASI_Mm01_00191944 predicted 1228
4 SASI_Mm01_00191945 predicted 972
5 SASI_Mm01_00191946 predicted 1133
6 SASI_Mm01_00191948 predicted 1394
7 SASI_Mm01_00191949 predicted 1306
8 SASI_Mm01_00191950 predicted 1392
9 SASI_Mm01_00191951 predicted 846
10 SASI_Mm02_00339879 predicted 1290
11 SASI_Mm01_00191947 predicted 1638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023071
VALIDATED
SPATS2 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated, serine-rich 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-2625s1c1
Sequence:CCGGCCCAATGCCTTGTTTCCTATTCTCGAGAATAGGAAACAAGGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023071.1-1533s1c1
Sequence:CCGGCCCGATGTAGCTCAGTTACATCTCGAGATGTAACTGAGCTACATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-1145s1c1
Sequence:CCGGGCACGGTATCGAGTTGTAGTTCTCGAGAACTACAACTCGATACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-1396s1c1
Sequence:CCGGGCACTTTGTTAGTGAACGTAACTCGAGTTACGTTCACTAACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023071.1-1621s1c1
Sequence:CCGGCCTTACAAGTGCTAACAAGAACTCGAGTTCTTGTTAGCACTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-2631s1c1
Sequence:CCGGGCCTTGTTTCCTATTACCTTACTCGAGTAAGGTAATAGGAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023071.3-3233s21c1
Sequence:CCGGGCCTTGTTTCCTATTACCTTACTCGAGTAAGGTAATAGGAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-2222s21c1
Sequence:CCGGCCTTACAAGTGCTAACAAGAACTCGAGTTCTTGTTAGCACTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-1746s21c1
Sequence:CCGGGCACGGTATCGAGTTGTAGTTCTCGAGAACTACAACTCGATACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-1997s21c1
Sequence:CCGGGCACTTTGTTAGTGAACGTAACTCGAGTTACGTTCACTAACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023071
VALIDATED
SPATS2 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated, serine-rich 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-2625s1c1
Sequence:CCGGCCCAATGCCTTGTTTCCTATTCTCGAGAATAGGAAACAAGGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023071.1-1533s1c1
Sequence:CCGGCCCGATGTAGCTCAGTTACATCTCGAGATGTAACTGAGCTACATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-1145s1c1
Sequence:CCGGGCACGGTATCGAGTTGTAGTTCTCGAGAACTACAACTCGATACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-1396s1c1
Sequence:CCGGGCACTTTGTTAGTGAACGTAACTCGAGTTACGTTCACTAACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023071.1-1621s1c1
Sequence:CCGGCCTTACAAGTGCTAACAAGAACTCGAGTTCTTGTTAGCACTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-2631s1c1
Sequence:CCGGGCCTTGTTTCCTATTACCTTACTCGAGTAAGGTAATAGGAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023071.3-3233s21c1
Sequence:CCGGGCCTTGTTTCCTATTACCTTACTCGAGTAAGGTAATAGGAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-2222s21c1
Sequence:CCGGCCTTACAAGTGCTAACAAGAACTCGAGTTCTTGTTAGCACTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-1746s21c1
Sequence:CCGGGCACGGTATCGAGTTGTAGTTCTCGAGAACTACAACTCGATACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-1997s21c1
Sequence:CCGGGCACTTTGTTAGTGAACGTAACTCGAGTTACGTTCACTAACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023071
VALIDATED
SPATS2 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated, serine-rich 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-2625s1c1
Sequence:CCGGCCCAATGCCTTGTTTCCTATTCTCGAGAATAGGAAACAAGGCATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023071.1-1533s1c1
Sequence:CCGGCCCGATGTAGCTCAGTTACATCTCGAGATGTAACTGAGCTACATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-1145s1c1
Sequence:CCGGGCACGGTATCGAGTTGTAGTTCTCGAGAACTACAACTCGATACCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-1396s1c1
Sequence:CCGGGCACTTTGTTAGTGAACGTAACTCGAGTTACGTTCACTAACAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023071.1-1621s1c1
Sequence:CCGGCCTTACAAGTGCTAACAAGAACTCGAGTTCTTGTTAGCACTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023071.1-2631s1c1
Sequence:CCGGGCCTTGTTTCCTATTACCTTACTCGAGTAAGGTAATAGGAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023071.3-3233s21c1
Sequence:CCGGGCCTTGTTTCCTATTACCTTACTCGAGTAAGGTAATAGGAAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-2222s21c1
Sequence:CCGGCCTTACAAGTGCTAACAAGAACTCGAGTTCTTGTTAGCACTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-1746s21c1
Sequence:CCGGGCACGGTATCGAGTTGTAGTTCTCGAGAACTACAACTCGATACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023071.3-1997s21c1
Sequence:CCGGGCACTTTGTTAGTGAACGTAACTCGAGTTACGTTCACTAACAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139140
VALIDATED
SPATS2 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated, serine-rich 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1324s1c1
Sequence:CCGGCACTTTGTCAGTGAGCGGAAACTCGAGTTTCCGCTCACTGACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1419s1c1
Sequence:CCGGCGGACAAGTGTCACATCCAAACTCGAGTTTGGATGTGACACTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1140s1c1
Sequence:CCGGCGAATTGCAAAGCTGTTTAATCTCGAGATTAAACAGCTTTGCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-546s1c1
Sequence:CCGGGCTCAAAGAATGGATAGTAACCTCGAGGTTACTATCCATTCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-880s21c1
Sequence:CCGGTCTTTGACTGCGCACTCTATCCTCGAGGATAGAGTGCGCAGTCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-1327s21c1
Sequence:CCGGTTTGTCAGTGAGCGGAAATATCTCGAGATATTTCCGCTCACTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139140.1-696s21c1
Sequence:CCGGCATCAATGGTTACCACGTAAACTCGAGTTTACGTGGTAACCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-1140s21c1
Sequence:CCGGCGAATTGCAAAGCTGTTTAATCTCGAGATTAAACAGCTTTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-991s21c1
Sequence:CCGGCCACTCTCTTCCACCAATAAACTCGAGTTTATTGGTGGAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139140
VALIDATED
SPATS2 MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated, serine-rich 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1324s1c1
Sequence:CCGGCACTTTGTCAGTGAGCGGAAACTCGAGTTTCCGCTCACTGACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1419s1c1
Sequence:CCGGCGGACAAGTGTCACATCCAAACTCGAGTTTGGATGTGACACTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1140s1c1
Sequence:CCGGCGAATTGCAAAGCTGTTTAATCTCGAGATTAAACAGCTTTGCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-546s1c1
Sequence:CCGGGCTCAAAGAATGGATAGTAACCTCGAGGTTACTATCCATTCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-880s21c1
Sequence:CCGGTCTTTGACTGCGCACTCTATCCTCGAGGATAGAGTGCGCAGTCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-1327s21c1
Sequence:CCGGTTTGTCAGTGAGCGGAAATATCTCGAGATATTTCCGCTCACTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139140.1-696s21c1
Sequence:CCGGCATCAATGGTTACCACGTAAACTCGAGTTTACGTGGTAACCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-1140s21c1
Sequence:CCGGCGAATTGCAAAGCTGTTTAATCTCGAGATTAAACAGCTTTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-991s21c1
Sequence:CCGGCCACTCTCTTCCACCAATAAACTCGAGTTTATTGGTGGAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139140
VALIDATED
SPATS2 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated, serine-rich 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1324s1c1
Sequence:CCGGCACTTTGTCAGTGAGCGGAAACTCGAGTTTCCGCTCACTGACAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1419s1c1
Sequence:CCGGCGGACAAGTGTCACATCCAAACTCGAGTTTGGATGTGACACTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-1140s1c1
Sequence:CCGGCGAATTGCAAAGCTGTTTAATCTCGAGATTAAACAGCTTTGCAATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139140.1-546s1c1
Sequence:CCGGGCTCAAAGAATGGATAGTAACCTCGAGGTTACTATCCATTCTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-880s21c1
Sequence:CCGGTCTTTGACTGCGCACTCTATCCTCGAGGATAGAGTGCGCAGTCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-1327s21c1
Sequence:CCGGTTTGTCAGTGAGCGGAAATATCTCGAGATATTTCCGCTCACTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139140.1-696s21c1
Sequence:CCGGCATCAATGGTTACCACGTAAACTCGAGTTTACGTGGTAACCATTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-1140s21c1
Sequence:CCGGCGAATTGCAAAGCTGTTTAATCTCGAGATTAAACAGCTTTGCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139140.1-991s21c1
Sequence:CCGGCCACTCTCTTCCACCAATAAACTCGAGTTTATTGGTGGAAGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks