EMAIL THIS PAGE TO A FRIEND

SPATS2L

spermatogenesis associated, serine-rich 2-like

Synonyms: DNAPTP6 SGNP
Gene ID:
Mouse(67198) spermatogenesis associated, serine-rich 2-like
Rat(316426) spermatogenesis associated, serine-rich 2-like
naked mole-rat(101726168) spermatogenesis associated, serine-rich 2-like
domestic guinea pig(100721031) spermatogenesis associated, serine-rich 2-like
cow(539299) spermatogenesis associated, serine-rich 2-like
sheep(101103625) spermatogenesis associated, serine-rich 2-like
chicken(424067) spermatogenesis associated, serine-rich 2-like
Horse(100070923) spermatogenesis associated, serine-rich 2-like
domestic cat(101091133) spermatogenesis associated, serine-rich 2-like
dog(478862) spermatogenesis associated, serine-rich 2-like
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015535 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100422 Rosetta Predictions human pricing
NM_001100423 Rosetta Predictions human pricing
NM_001100424 Rosetta Predictions human pricing
NM_015535 Rosetta Predictions human pricing
NM_001014102 Rosetta Predictions rat pricing
NM_144882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322054 predicted 2398
2 SASI_Hs02_00322055 predicted 2380
3 SASI_Hs02_00322056 predicted 2418
4 SASI_Hs02_00322057 predicted 2140
5 SASI_Hs02_00322058 predicted 1429
6 SASI_Hs02_00322059 predicted 2380
7 SASI_Hs02_00322060 predicted 2185
8 SASI_Hs02_00322061 predicted 2412
9 SASI_Hs02_00322062 predicted 2277
10 SASI_Hs02_00322063 predicted 2163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322064 predicted 1533
2 SASI_Hs02_00322065 predicted 1315
3 SASI_Hs02_00322066 predicted 504
4 SASI_Hs02_00322067 predicted 2326
5 SASI_Hs02_00322068 predicted 1290
6 SASI_Hs02_00322069 predicted 1659
7 SASI_Hs02_00322070 predicted 2116
8 SASI_Hs02_00322071 predicted 1975
9 SASI_Hs02_00322072 predicted 2275
10 SASI_Hs02_00322073 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322074 predicted 2197
2 SASI_Hs02_00322075 predicted 2170
3 SASI_Hs02_00322076 predicted 2210
4 SASI_Hs02_00322077 predicted 1934
5 SASI_Hs02_00322078 predicted 1228
6 SASI_Hs02_00322079 predicted 2165
7 SASI_Hs02_00322080 predicted 1980
8 SASI_Hs02_00322081 predicted 2203
9 SASI_Hs02_00322082 predicted 2069
10 SASI_Hs02_00322083 predicted 1954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348056 predicted 1525
2 SASI_Hs01_00043586 predicted 1302
3 SASI_Hs02_00348057 predicted 2319
4 SASI_Hs02_00348058 predicted 1280
5 SASI_Hs02_00348059 predicted 1654
6 SASI_Hs02_00348060 predicted 2219
7 SASI_Hs01_00043589 predicted 2101
8 SASI_Hs02_00348061 predicted 1957
9 SASI_Hs02_00348062 predicted 2265
10 SASI_Hs02_00348063 predicted 1937
11 SASI_Hs01_00043580 predicted 716
12 SASI_Hs01_00043581 predicted 1497
13 SASI_Hs01_00043582 predicted 866
14 SASI_Hs01_00043583 predicted 891
15 SASI_Hs01_00043584 predicted 1484
16 SASI_Hs01_00043585 predicted 615
17 SASI_Hs01_00043587 predicted 1038
18 SASI_Hs01_00043588 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087161 predicted 329
2 SASI_Rn01_00087162 predicted 2062
3 SASI_Rn01_00087163 predicted 1625
4 SASI_Rn01_00087164 predicted 1190
5 SASI_Rn01_00087165 predicted 987
6 SASI_Rn01_00087166 predicted 301
7 SASI_Rn01_00087167 predicted 1600
8 SASI_Rn01_00087168 predicted 2048
9 SASI_Rn01_00087169 predicted 947
10 SASI_Rn01_00087170 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143614 predicted 1581
2 SASI_Mm01_00143615 predicted 399
3 SASI_Mm01_00143616 predicted 1852
4 SASI_Mm01_00143617 predicted 290
5 SASI_Mm01_00143618 predicted 1999
6 SASI_Mm01_00143620 predicted 944
7 SASI_Mm01_00143621 predicted 1562
8 SASI_Mm02_00340332 predicted 1290
9 SASI_Mm01_00143622 predicted 742
10 SASI_Mm01_00143623 predicted 464
11 SASI_Mm01_00143619 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015535
VALIDATED
SPATS2L MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated, serine-rich 2-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1214s21c1
Sequence:CCGGGCTCGTCAGAAGAAAGCAGAACTCGAGTTCTGCTTTCTTCTGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-702s21c1
Sequence:CCGGCCACAGATTCTGCTAACGAAACTCGAGTTTCGTTAGCAGAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1655s21c1
Sequence:CCGGCGGAGATTTAATCCACAGTATCTCGAGATACTGTGGATTAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1405s21c1
Sequence:CCGGCGGAGAAATTACACATCCAAACTCGAGTTTGGATGTGTAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1044s21c1
Sequence:CCGGGCACCGTTTCTCTAACTAGATCTCGAGATCTAGTTAGAGAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1213s1c1
Sequence:CCGGCGGAGAAATTACACATCCAAACTCGAGTTTGGATGTGTAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-852s1c1
Sequence:CCGGGCACCGTTTCTCTAACTAGATCTCGAGATCTAGTTAGAGAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1463s1c1
Sequence:CCGGCGGAGATTTAATCCACAGTATCTCGAGATACTGTGGATTAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1022s1c1
Sequence:CCGGGCTCGTCAGAAGAAAGCAGAACTCGAGTTCTGCTTTCTTCTGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-510s1c1
Sequence:CCGGCCACAGATTCTGCTAACGAAACTCGAGTTTCGTTAGCAGAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015535
VALIDATED
SPATS2L MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated, serine-rich 2-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1214s21c1
Sequence:CCGGGCTCGTCAGAAGAAAGCAGAACTCGAGTTCTGCTTTCTTCTGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-702s21c1
Sequence:CCGGCCACAGATTCTGCTAACGAAACTCGAGTTTCGTTAGCAGAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1655s21c1
Sequence:CCGGCGGAGATTTAATCCACAGTATCTCGAGATACTGTGGATTAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1405s21c1
Sequence:CCGGCGGAGAAATTACACATCCAAACTCGAGTTTGGATGTGTAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1044s21c1
Sequence:CCGGGCACCGTTTCTCTAACTAGATCTCGAGATCTAGTTAGAGAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1213s1c1
Sequence:CCGGCGGAGAAATTACACATCCAAACTCGAGTTTGGATGTGTAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-852s1c1
Sequence:CCGGGCACCGTTTCTCTAACTAGATCTCGAGATCTAGTTAGAGAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1463s1c1
Sequence:CCGGCGGAGATTTAATCCACAGTATCTCGAGATACTGTGGATTAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1022s1c1
Sequence:CCGGGCTCGTCAGAAGAAAGCAGAACTCGAGTTCTGCTTTCTTCTGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-510s1c1
Sequence:CCGGCCACAGATTCTGCTAACGAAACTCGAGTTTCGTTAGCAGAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015535
VALIDATED
SPATS2L MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated, serine-rich 2-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1214s21c1
Sequence:CCGGGCTCGTCAGAAGAAAGCAGAACTCGAGTTCTGCTTTCTTCTGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-702s21c1
Sequence:CCGGCCACAGATTCTGCTAACGAAACTCGAGTTTCGTTAGCAGAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1655s21c1
Sequence:CCGGCGGAGATTTAATCCACAGTATCTCGAGATACTGTGGATTAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1405s21c1
Sequence:CCGGCGGAGAAATTACACATCCAAACTCGAGTTTGGATGTGTAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015535.2-1044s21c1
Sequence:CCGGGCACCGTTTCTCTAACTAGATCTCGAGATCTAGTTAGAGAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1213s1c1
Sequence:CCGGCGGAGAAATTACACATCCAAACTCGAGTTTGGATGTGTAATTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-852s1c1
Sequence:CCGGGCACCGTTTCTCTAACTAGATCTCGAGATCTAGTTAGAGAAACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1463s1c1
Sequence:CCGGCGGAGATTTAATCCACAGTATCTCGAGATACTGTGGATTAAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-1022s1c1
Sequence:CCGGGCTCGTCAGAAGAAAGCAGAACTCGAGTTCTGCTTTCTTCTGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015535.1-510s1c1
Sequence:CCGGCCACAGATTCTGCTAACGAAACTCGAGTTTCGTTAGCAGAATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144882
VALIDATED
SPATS2L MISSION shRNA Bacterial Glycerol Stock
spermatogenesis associated, serine-rich 2-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-997s21c1
Sequence:CCGGGTTCCGTGAAGAAGATCAAAGCTCGAGCTTTGATCTTCTTCACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-404s1c1
Sequence:CCGGCAGTGCTATTCAAGTTCTTAACTCGAGTTAAGAACTTGAATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-347s1c1
Sequence:CCGGGGTACTCCAACAGTTTGATTTCTCGAGAAATCAAACTGTTGGAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-1190s1c1
Sequence:CCGGCGAACTCAGAGCTGAAATTAACTCGAGTTAATTTCAGCTCTGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1548s21c1
Sequence:CCGGTCCAGCCAAAGACGAAGATTTCTCGAGAAATCTTCGTCTTTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1216s21c1
Sequence:CCGGTTGTCAGCGAACGCAAGTATGCTCGAGCATACTTGCGTTCGCTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144882.3-2759s21c1
Sequence:CCGGTCCATATTCTGACACTATATTCTCGAGAATATAGTGTCAGAATATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1841s21c1
Sequence:CCGGGGTTTCACAGTGCAATCTTTGCTCGAGCAAAGATTGCACTGTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.2-1854s1c1
Sequence:CCGGGCAATCTTTGTCCCTCTAGAACTCGAGTTCTAGAGGGACAAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144882.2-2164s1c1
Sequence:CCGGGCCAGCCAGTATTTACTCATTCTCGAGAATGAGTAAATACTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144882
VALIDATED
SPATS2L MISSION shRNA shRNA Plasmid DNA
spermatogenesis associated, serine-rich 2-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-997s21c1
Sequence:CCGGGTTCCGTGAAGAAGATCAAAGCTCGAGCTTTGATCTTCTTCACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-404s1c1
Sequence:CCGGCAGTGCTATTCAAGTTCTTAACTCGAGTTAAGAACTTGAATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-347s1c1
Sequence:CCGGGGTACTCCAACAGTTTGATTTCTCGAGAAATCAAACTGTTGGAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-1190s1c1
Sequence:CCGGCGAACTCAGAGCTGAAATTAACTCGAGTTAATTTCAGCTCTGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1548s21c1
Sequence:CCGGTCCAGCCAAAGACGAAGATTTCTCGAGAAATCTTCGTCTTTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1216s21c1
Sequence:CCGGTTGTCAGCGAACGCAAGTATGCTCGAGCATACTTGCGTTCGCTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144882.3-2759s21c1
Sequence:CCGGTCCATATTCTGACACTATATTCTCGAGAATATAGTGTCAGAATATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1841s21c1
Sequence:CCGGGGTTTCACAGTGCAATCTTTGCTCGAGCAAAGATTGCACTGTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.2-1854s1c1
Sequence:CCGGGCAATCTTTGTCCCTCTAGAACTCGAGTTCTAGAGGGACAAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144882.2-2164s1c1
Sequence:CCGGGCCAGCCAGTATTTACTCATTCTCGAGAATGAGTAAATACTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144882
VALIDATED
SPATS2L MISSION shRNA Lentiviral Transduction Particles
spermatogenesis associated, serine-rich 2-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-997s21c1
Sequence:CCGGGTTCCGTGAAGAAGATCAAAGCTCGAGCTTTGATCTTCTTCACGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-404s1c1
Sequence:CCGGCAGTGCTATTCAAGTTCTTAACTCGAGTTAAGAACTTGAATAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-347s1c1
Sequence:CCGGGGTACTCCAACAGTTTGATTTCTCGAGAAATCAAACTGTTGGAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.3-1190s1c1
Sequence:CCGGCGAACTCAGAGCTGAAATTAACTCGAGTTAATTTCAGCTCTGAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1548s21c1
Sequence:CCGGTCCAGCCAAAGACGAAGATTTCTCGAGAAATCTTCGTCTTTGGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1216s21c1
Sequence:CCGGTTGTCAGCGAACGCAAGTATGCTCGAGCATACTTGCGTTCGCTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144882.3-2759s21c1
Sequence:CCGGTCCATATTCTGACACTATATTCTCGAGAATATAGTGTCAGAATATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144882.3-1841s21c1
Sequence:CCGGGGTTTCACAGTGCAATCTTTGCTCGAGCAAAGATTGCACTGTGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144882.2-1854s1c1
Sequence:CCGGGCAATCTTTGTCCCTCTAGAACTCGAGTTCTAGAGGGACAAAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192677    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144882.2-2164s1c1
Sequence:CCGGGCCAGCCAGTATTTACTCATTCTCGAGAATGAGTAAATACTGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks