EMAIL THIS PAGE TO A FRIEND

SPC24

SPC24, NDC80 kinetochore complex component

Synonyms: SPBC24
UniProtKB ID: Q8NBT2, C9JGC4
Gene ID:
Mouse(67629) SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Rat(363028) SPC24, NDC80 kinetochore complex component
Zebrafish(554147) SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
domestic cat(101097301) SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
dog(611174) SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
cow(509117) SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
sheep(101117500) SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
naked mole-rat(101704319) SPC24, NDC80 kinetochore complex component
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182513 Rosetta Predictions human pricing
XM_001077474 Rosetta Predictions rat pricing
XM_343359 Rosetta Predictions rat pricing
NM_026282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370586 predicted 328
2 SASI_Hs01_00245697 predicted 401
3 SASI_Hs01_00245698 predicted 405
4 SASI_Hs02_00370587 predicted 404
5 SASI_Hs02_00370588 predicted 392
6 SASI_Hs02_00370589 predicted 428
7 SASI_Hs02_00370590 predicted 399
8 SASI_Hs02_00370591 predicted 243
9 SASI_Hs02_00370592 predicted 213
10 SASI_Hs02_00370593 predicted 216
11 SASI_Hs01_00245692 predicted 419
12 SASI_Hs01_00245693 predicted 413
13 SASI_Hs01_00245694 predicted 410
14 SASI_Hs01_00245695 predicted 428
15 SASI_Hs01_00245696 predicted 425
16 SASI_Hs01_00245699 predicted 407
17 SASI_Hs01_00245700 predicted 425
18 SASI_Hs01_00245701 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357165 predicted 414
2 SASI_Rn02_00357166 predicted 534
3 SASI_Rn02_00357167 predicted 505
4 SASI_Rn02_00357168 predicted 416
5 SASI_Rn02_00357169 predicted 421
6 SASI_Rn02_00357170 predicted 419
7 SASI_Rn02_00357171 predicted 441
8 SASI_Rn02_00357172 predicted 340
9 SASI_Rn02_00357173 predicted 404
10 SASI_Rn02_00357174 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395693 predicted 414
2 SASI_Rn02_00395694 predicted 541
3 SASI_Rn02_00395695 predicted 509
4 SASI_Rn02_00395696 predicted 422
5 SASI_Rn02_00395697 predicted 416
6 SASI_Rn02_00395698 predicted 423
7 SASI_Rn02_00395699 predicted 444
8 SASI_Rn02_00395700 predicted 338
9 SASI_Rn02_00395701 predicted 404
10 SASI_Rn02_00395702 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329975 predicted 544
2 SASI_Mm02_00329976 predicted 414
3 SASI_Mm02_00329977 predicted 672
4 SASI_Mm02_00329978 predicted 683
5 SASI_Mm02_00329979 predicted 469
6 SASI_Mm02_00329980 predicted 537
7 SASI_Mm02_00329981 predicted 416
8 SASI_Mm02_00329982 predicted 405
9 SASI_Mm02_00329983 predicted 429
10 SASI_Mm02_00329984 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026282
VALIDATED
SPC24 MISSION shRNA Bacterial Glycerol Stock
SPC24, NDC80 kinetochore complex component
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-424s1c1
Sequence:CCGGGTGGCTCATCTCTATCACCAACTCGAGTTGGTGATAGAGATGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-691s1c1
Sequence:CCGGGTGCGTTCATTGATTTATCTACTCGAGTAGATAAATCAATGAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026282.2-801s1c1
Sequence:CCGGGTGTGTCTGTTAGCTGTGTATCTCGAGATACACAGCTAACAGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-428s1c1
Sequence:CCGGCTCATCTCTATCACCAAATTACTCGAGTAATTTGGTGATAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026282
VALIDATED
SPC24 MISSION shRNA shRNA Plasmid DNA
SPC24, NDC80 kinetochore complex component
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-424s1c1
Sequence:CCGGGTGGCTCATCTCTATCACCAACTCGAGTTGGTGATAGAGATGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-691s1c1
Sequence:CCGGGTGCGTTCATTGATTTATCTACTCGAGTAGATAAATCAATGAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026282.2-801s1c1
Sequence:CCGGGTGTGTCTGTTAGCTGTGTATCTCGAGATACACAGCTAACAGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-428s1c1
Sequence:CCGGCTCATCTCTATCACCAAATTACTCGAGTAATTTGGTGATAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026282
VALIDATED
SPC24 MISSION shRNA Lentiviral Transduction Particles
SPC24, NDC80 kinetochore complex component
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-424s1c1
Sequence:CCGGGTGGCTCATCTCTATCACCAACTCGAGTTGGTGATAGAGATGAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183442    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-691s1c1
Sequence:CCGGGTGCGTTCATTGATTTATCTACTCGAGTAGATAAATCAATGAACGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026282.2-801s1c1
Sequence:CCGGGTGTGTCTGTTAGCTGTGTATCTCGAGATACACAGCTAACAGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026282.2-428s1c1
Sequence:CCGGCTCATCTCTATCACCAAATTACTCGAGTAATTTGGTGATAGAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182513
SPC24 MISSION shRNA Bacterial Glycerol Stock
SPC24, NDC80 kinetochore complex component
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-328s1c1
Sequence:CCGGCTGGAAGAGCTCAAGGAGATTCTCGAGAATCTCCTTGAGCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-414s1c1
Sequence:CCGGCGTGTACGTGGCTCAACTTTACTCGAGTAAAGTTGAGCCACGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182513.1-644s1c1
Sequence:CCGGCGTGGTCAGATCCATTTCAAACTCGAGTTTGAAATGGATCTGACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-549s1c1
Sequence:CCGGCAGGAAATTCATCAGCGACTACTCGAGTAGTCGCTGATGAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-552s1c1
Sequence:CCGGGAAATTCATCAGCGACTACCTCTCGAGAGGTAGTCGCTGATGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-430s1c1
Sequence:CCGGCTTTACCACCAAGTTAGTAAACTCGAGTTTACTAACTTGGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182513.1-1961s1c1
Sequence:CCGGCCAGTGAAATGTATGTGGAAACTCGAGTTTCCACATACATTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-425s1c1
Sequence:CCGGCTCAACTTTACCACCAAGTTACTCGAGTAACTTGGTGGTAAAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-424s1c1
Sequence:CCGGGCTCAACTTTACCACCAAGTTCTCGAGAACTTGGTGGTAAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-496s21c1
Sequence:CCCGGTGAGCCAGGGATGGTCAAAGCTCGAGCTTTGACCATCCCTGGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-222s21c1
Sequence:CCGGCAGAGCCTTCTCAATGCGAAGCTCGAGCTTCGCATTGAGAAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-411s21c1
Sequence:CCGGGAGGACACGACAGTCACAATCCTCGAGGATTGTGACTGTCGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-365s21c1
Sequence:CCGGCAAGGAGATTGAGGCGGATCTCTCGAGAGATCCGCCTCAATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182513
SPC24 MISSION shRNA shRNA Plasmid DNA
SPC24, NDC80 kinetochore complex component
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-328s1c1
Sequence:CCGGCTGGAAGAGCTCAAGGAGATTCTCGAGAATCTCCTTGAGCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-414s1c1
Sequence:CCGGCGTGTACGTGGCTCAACTTTACTCGAGTAAAGTTGAGCCACGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182513.1-644s1c1
Sequence:CCGGCGTGGTCAGATCCATTTCAAACTCGAGTTTGAAATGGATCTGACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-549s1c1
Sequence:CCGGCAGGAAATTCATCAGCGACTACTCGAGTAGTCGCTGATGAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-552s1c1
Sequence:CCGGGAAATTCATCAGCGACTACCTCTCGAGAGGTAGTCGCTGATGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-430s1c1
Sequence:CCGGCTTTACCACCAAGTTAGTAAACTCGAGTTTACTAACTTGGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182513.1-1961s1c1
Sequence:CCGGCCAGTGAAATGTATGTGGAAACTCGAGTTTCCACATACATTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-425s1c1
Sequence:CCGGCTCAACTTTACCACCAAGTTACTCGAGTAACTTGGTGGTAAAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-424s1c1
Sequence:CCGGGCTCAACTTTACCACCAAGTTCTCGAGAACTTGGTGGTAAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-496s21c1
Sequence:CCCGGTGAGCCAGGGATGGTCAAAGCTCGAGCTTTGACCATCCCTGGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-222s21c1
Sequence:CCGGCAGAGCCTTCTCAATGCGAAGCTCGAGCTTCGCATTGAGAAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-411s21c1
Sequence:CCGGGAGGACACGACAGTCACAATCCTCGAGGATTGTGACTGTCGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-365s21c1
Sequence:CCGGCAAGGAGATTGAGGCGGATCTCTCGAGAGATCCGCCTCAATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182513
SPC24 MISSION shRNA Lentiviral Transduction Particles
SPC24, NDC80 kinetochore complex component
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166712    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-328s1c1
Sequence:CCGGCTGGAAGAGCTCAAGGAGATTCTCGAGAATCTCCTTGAGCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-414s1c1
Sequence:CCGGCGTGTACGTGGCTCAACTTTACTCGAGTAAAGTTGAGCCACGTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164175    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182513.1-644s1c1
Sequence:CCGGCGTGGTCAGATCCATTTCAAACTCGAGTTTGAAATGGATCTGACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-549s1c1
Sequence:CCGGCAGGAAATTCATCAGCGACTACTCGAGTAGTCGCTGATGAATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-552s1c1
Sequence:CCGGGAAATTCATCAGCGACTACCTCTCGAGAGGTAGTCGCTGATGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-430s1c1
Sequence:CCGGCTTTACCACCAAGTTAGTAAACTCGAGTTTACTAACTTGGTGGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182513.1-1961s1c1
Sequence:CCGGCCAGTGAAATGTATGTGGAAACTCGAGTTTCCACATACATTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-425s1c1
Sequence:CCGGCTCAACTTTACCACCAAGTTACTCGAGTAACTTGGTGGTAAAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163590    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182513.1-424s1c1
Sequence:CCGGGCTCAACTTTACCACCAAGTTCTCGAGAACTTGGTGGTAAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-496s21c1
Sequence:CCCGGTGAGCCAGGGATGGTCAAAGCTCGAGCTTTGACCATCCCTGGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-222s21c1
Sequence:CCGGCAGAGCCTTCTCAATGCGAAGCTCGAGCTTCGCATTGAGAAGGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-411s21c1
Sequence:CCGGGAGGACACGACAGTCACAATCCTCGAGGATTGTGACTGTCGTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182513.2-365s21c1
Sequence:CCGGCAAGGAGATTGAGGCGGATCTCTCGAGAGATCCGCCTCAATCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks