EMAIL THIS PAGE TO A FRIEND

SPC25

SPC25, NDC80 kinetochore complex component

Synonyms: SPBC25 hSpc25
UniProtKB ID: Q9HBM1, A8K4X8, D3DPC0
Gene ID:
Human(57405) Summary: This gene encodes a protein that may be involved in kinetochore-microtubule interaction and spindle checkpoint activity. [provided by RefSeq, Jul 2008]
Mouse(66442) SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Rat(295661) SPC25, NDC80 kinetochore complex component
naked mole-rat(101714677) SPC25, NDC80 kinetochore complex component
domestic guinea pig(100712785) SPC25, NDC80 kinetochore complex component
cow(505011) SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
sheep(101121749) SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
fruit fly(41585) CG7242 gene product from transcript CG7242-RA
domestic cat(101085229) SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
dog(488388) SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
chicken(424172) SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Zebrafish(100144563) SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020675 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020675 Rosetta Predictions human pricing
NM_001009654 Rosetta Predictions rat pricing
NM_025565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193697 predicted 428
2 SASI_Hs01_00193698 predicted 206
3 SASI_Hs01_00193699 predicted 618
4 SASI_Hs01_00193700 predicted 518
5 SASI_Hs01_00193701 predicted 278
6 SASI_Hs01_00193702 predicted 244
7 SASI_Hs02_00353664 predicted 581
8 SASI_Hs01_00193703 predicted 432
9 SASI_Hs01_00193704 predicted 493
10 SASI_Hs01_00193705 predicted 293
11 SASI_Hs01_00193706 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066478 predicted 734
2 SASI_Rn01_00066479 predicted 598
3 SASI_Rn01_00066480 predicted 245
4 SASI_Rn01_00066482 predicted 463
5 SASI_Rn01_00066483 predicted 790
6 SASI_Rn01_00066484 predicted 536
7 SASI_Rn01_00066485 predicted 438
8 SASI_Rn01_00066486 predicted 320
9 SASI_Rn01_00066487 predicted 274
10 SASI_Rn02_00199682 predicted 762
11 SASI_Rn01_00066481 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162175 predicted 407
2 SASI_Mm01_00162176 predicted 476
3 SASI_Mm01_00162178 predicted 586
4 SASI_Mm02_00328540 predicted 334
5 SASI_Mm01_00162179 predicted 395
6 SASI_Mm01_00162180 predicted 378
7 SASI_Mm01_00162181 predicted 714
8 SASI_Mm01_00162182 predicted 347
9 SASI_Mm01_00162183 predicted 619
10 SASI_Mm01_00162184 predicted 619
11 SASI_Mm01_00162177 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025565
VALIDATED
SPC25 MISSION shRNA Bacterial Glycerol Stock
SPC25, NDC80 kinetochore complex component
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-323s21c1
Sequence:CCGGACAAAGCTAATGAAGAGAGATCTCGAGATCTCTCTTCATTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-159s21c1
Sequence:CCGGCCAGCTCTGTAAGCAGAATAACTCGAGTTATTCTGCTTACAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025565.2-705s21c1
Sequence:CCGGCTCTTTCTGTGTGGTATTAAACTCGAGTTTAATACCACACAGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-384s21c1
Sequence:CCGGCCTTGGACTAGAAATTAGAAACTCGAGTTTCTAATTTCTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-878s1c1
Sequence:CCGGCCACAAAGAAAGATAGAAGTTCTCGAGAACTTCTATCTTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-385s1c1
Sequence:CCGGCCTTGGACTAGAAATTAGAAACTCGAGTTTCTAATTTCTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-160s1c1
Sequence:CCGGCCAGCTCTGTAAGCAGAATAACTCGAGTTATTCTGCTTACAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-324s1c1
Sequence:CCGGACAAAGCTAATGAAGAGAGATCTCGAGATCTCTCTTCATTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025565.1-486s1c1
Sequence:CCGGGCATAAATGAAGCTAAGGAATCTCGAGATTCCTTAGCTTCATTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025565
VALIDATED
SPC25 MISSION shRNA shRNA Plasmid DNA
SPC25, NDC80 kinetochore complex component
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-323s21c1
Sequence:CCGGACAAAGCTAATGAAGAGAGATCTCGAGATCTCTCTTCATTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-159s21c1
Sequence:CCGGCCAGCTCTGTAAGCAGAATAACTCGAGTTATTCTGCTTACAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025565.2-705s21c1
Sequence:CCGGCTCTTTCTGTGTGGTATTAAACTCGAGTTTAATACCACACAGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-384s21c1
Sequence:CCGGCCTTGGACTAGAAATTAGAAACTCGAGTTTCTAATTTCTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-878s1c1
Sequence:CCGGCCACAAAGAAAGATAGAAGTTCTCGAGAACTTCTATCTTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-385s1c1
Sequence:CCGGCCTTGGACTAGAAATTAGAAACTCGAGTTTCTAATTTCTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-160s1c1
Sequence:CCGGCCAGCTCTGTAAGCAGAATAACTCGAGTTATTCTGCTTACAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-324s1c1
Sequence:CCGGACAAAGCTAATGAAGAGAGATCTCGAGATCTCTCTTCATTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025565.1-486s1c1
Sequence:CCGGGCATAAATGAAGCTAAGGAATCTCGAGATTCCTTAGCTTCATTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025565
VALIDATED
SPC25 MISSION shRNA Lentiviral Transduction Particles
SPC25, NDC80 kinetochore complex component
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-323s21c1
Sequence:CCGGACAAAGCTAATGAAGAGAGATCTCGAGATCTCTCTTCATTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-159s21c1
Sequence:CCGGCCAGCTCTGTAAGCAGAATAACTCGAGTTATTCTGCTTACAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025565.2-705s21c1
Sequence:CCGGCTCTTTCTGTGTGGTATTAAACTCGAGTTTAATACCACACAGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025565.2-384s21c1
Sequence:CCGGCCTTGGACTAGAAATTAGAAACTCGAGTTTCTAATTTCTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-878s1c1
Sequence:CCGGCCACAAAGAAAGATAGAAGTTCTCGAGAACTTCTATCTTTCTTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-385s1c1
Sequence:CCGGCCTTGGACTAGAAATTAGAAACTCGAGTTTCTAATTTCTAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-160s1c1
Sequence:CCGGCCAGCTCTGTAAGCAGAATAACTCGAGTTATTCTGCTTACAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025565.1-324s1c1
Sequence:CCGGACAAAGCTAATGAAGAGAGATCTCGAGATCTCTCTTCATTAGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025565.1-486s1c1
Sequence:CCGGGCATAAATGAAGCTAAGGAATCTCGAGATTCCTTAGCTTCATTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020675
VALIDATED
SPC25 MISSION shRNA Bacterial Glycerol Stock
SPC25, NDC80 kinetochore complex component
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020675.3-1061s1c1
Sequence:CCGGCCTGTGTCCATGTGTTCTCATCTCGAGATGAGAACACATGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-426s1c1
Sequence:CCGGCTGACTGCAAATATCCAGGATCTCGAGATCCTGGATATTTGCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-239s1c1
Sequence:CCGGCAAGGATTCCATCAAAGCATTCTCGAGAATGCTTTGATGGAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-534s1c1
Sequence:CCGGGCAGACTTGTATAAAGATCGACTCGAGTCGATCTTTATACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-247s1c1
Sequence:CCGGCCATCAAAGCATTTGCAGAAACTCGAGTTTCTGCAAATGCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-537s1c1
Sequence:CCGGGACTTGTATAAAGATCGACTTCTCGAGAAGTCGATCTTTATACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-303s1c1
Sequence:CCGGGTTGAGATGTTTCTGGAATATCTCGAGATATTCCAGAAACATCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-728s1c1
Sequence:CCGGGAATGTAAGGAAGACCAACAACTCGAGTTGTTGGTCTTCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-294s1c1
Sequence:CCGGGAACGAATGGTTGAGATGTTTCTCGAGAAACATCTCAACCATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-1068s1c1
Sequence:CCGGCCATGTGTTCTCATTGTTCAACTCGAGTTGAACAATGAGAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-762s1c1
Sequence:CCGGCTTGCCAATGTTCGGAAAGCTCTCGAGAGCTTTCCGAACATTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020675
VALIDATED
SPC25 MISSION shRNA shRNA Plasmid DNA
SPC25, NDC80 kinetochore complex component
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020675.3-1061s1c1
Sequence:CCGGCCTGTGTCCATGTGTTCTCATCTCGAGATGAGAACACATGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-426s1c1
Sequence:CCGGCTGACTGCAAATATCCAGGATCTCGAGATCCTGGATATTTGCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-239s1c1
Sequence:CCGGCAAGGATTCCATCAAAGCATTCTCGAGAATGCTTTGATGGAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-534s1c1
Sequence:CCGGGCAGACTTGTATAAAGATCGACTCGAGTCGATCTTTATACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-247s1c1
Sequence:CCGGCCATCAAAGCATTTGCAGAAACTCGAGTTTCTGCAAATGCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-537s1c1
Sequence:CCGGGACTTGTATAAAGATCGACTTCTCGAGAAGTCGATCTTTATACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-303s1c1
Sequence:CCGGGTTGAGATGTTTCTGGAATATCTCGAGATATTCCAGAAACATCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-728s1c1
Sequence:CCGGGAATGTAAGGAAGACCAACAACTCGAGTTGTTGGTCTTCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-294s1c1
Sequence:CCGGGAACGAATGGTTGAGATGTTTCTCGAGAAACATCTCAACCATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-1068s1c1
Sequence:CCGGCCATGTGTTCTCATTGTTCAACTCGAGTTGAACAATGAGAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-762s1c1
Sequence:CCGGCTTGCCAATGTTCGGAAAGCTCTCGAGAGCTTTCCGAACATTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020675
VALIDATED
SPC25 MISSION shRNA Lentiviral Transduction Particles
SPC25, NDC80 kinetochore complex component
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166463    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020675.3-1061s1c1
Sequence:CCGGCCTGTGTCCATGTGTTCTCATCTCGAGATGAGAACACATGGACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-426s1c1
Sequence:CCGGCTGACTGCAAATATCCAGGATCTCGAGATCCTGGATATTTGCAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-239s1c1
Sequence:CCGGCAAGGATTCCATCAAAGCATTCTCGAGAATGCTTTGATGGAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161644    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-534s1c1
Sequence:CCGGGCAGACTTGTATAAAGATCGACTCGAGTCGATCTTTATACAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-247s1c1
Sequence:CCGGCCATCAAAGCATTTGCAGAAACTCGAGTTTCTGCAAATGCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-537s1c1
Sequence:CCGGGACTTGTATAAAGATCGACTTCTCGAGAAGTCGATCTTTATACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-303s1c1
Sequence:CCGGGTTGAGATGTTTCTGGAATATCTCGAGATATTCCAGAAACATCTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-728s1c1
Sequence:CCGGGAATGTAAGGAAGACCAACAACTCGAGTTGTTGGTCTTCCTTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-294s1c1
Sequence:CCGGGAACGAATGGTTGAGATGTTTCTCGAGAAACATCTCAACCATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162188    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020675.3-1068s1c1
Sequence:CCGGCCATGTGTTCTCATTGTTCAACTCGAGTTGAACAATGAGAACACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020675.3-762s1c1
Sequence:CCGGCTTGCCAATGTTCGGAAAGCTCTCGAGAGCTTTCCGAACATTGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks