EMAIL THIS PAGE TO A FRIEND

SPCS1

signal peptidase complex subunit 1 homolog (S. cerevisiae)

Synonyms: SPC1 SPC12 YJR010C-A
UniProtKB ID: Q9Y6A9, B3KNF8, Q9BVW1
Gene ID:
Mouse(69019) signal peptidase complex subunit 1 homolog (S. cerevisiae)
Rat(290555) signal peptidase complex subunit 1 homolog (S. cerevisiae)
Zebrafish(606666) signal peptidase complex subunit 1 homolog (S. cerevisiae)
domestic cat(101085957) signal peptidase complex subunit 1 homolog (S. cerevisiae)
dog(476592) signal peptidase complex subunit 1 homolog (S. cerevisiae)
chicken(415899) signal peptidase complex subunit 1 homolog (S. cerevisiae)
cow(511453) signal peptidase complex subunit 1 homolog (S. cerevisiae)
domestic guinea pig(100728204) signal peptidase complex subunit 1 homolog (S. cerevisiae)
naked mole-rat(101697222) signal peptidase complex subunit 1 homolog (S. cerevisiae)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014041 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014041 Rosetta Predictions human pricing
NM_001131006 Rosetta Predictions rat pricing
XM_214276 Rosetta Predictions rat pricing
NM_026911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134280 predicted 533
2 SASI_Hs01_00134281 predicted 499
3 SASI_Hs01_00134282 predicted 465
4 SASI_Hs01_00134283 predicted 551
5 SASI_Hs01_00134284 predicted 443
6 SASI_Hs01_00134285 predicted 619
7 SASI_Hs01_00134286 predicted 541
8 SASI_Hs01_00134287 predicted 641
9 SASI_Hs01_00134288 predicted 521
10 SASI_Hs01_00134289 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256159 predicted 352
2 SASI_Rn02_00256160 predicted 286
3 SASI_Rn02_00256161 predicted 273
4 SASI_Rn02_00256162 predicted 219
5 SASI_Rn02_00256163 predicted 369
6 SASI_Rn02_00256164 predicted 434
7 SASI_Rn02_00256165 predicted 295
8 SASI_Rn02_00256166 predicted 258
9 SASI_Rn02_00256167 predicted 429
10 SASI_Rn02_00256168 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214276 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165287 predicted 355
2 SASI_Rn01_00165288 predicted 292
3 SASI_Rn01_00165289 predicted 281
4 SASI_Rn01_00165290 predicted 216
5 SASI_Rn01_00165291 predicted 242
6 SASI_Rn01_00165292 predicted 429
7 SASI_Rn01_00165293 predicted 293
8 SASI_Rn01_00165294 predicted 283
9 SASI_Rn01_00165295 predicted 259
10 SASI_Rn01_00165296 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102845 predicted 539
2 SASI_Mm02_00331181 predicted 358
3 SASI_Mm01_00102846 predicted 771
4 SASI_Mm01_00102847 predicted 726
5 SASI_Mm01_00102850 predicted 541
6 SASI_Mm01_00102851 predicted 769
7 SASI_Mm01_00102852 predicted 738
8 SASI_Mm01_00102853 predicted 573
9 SASI_Mm02_00331182 predicted 381
10 SASI_Mm01_00102854 predicted 656
11 SASI_Mm01_00102848 predicted 314
12 SASI_Mm01_00102849 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014041
VALIDATED
SPCS1 MISSION shRNA Bacterial Glycerol Stock
signal peptidase complex subunit 1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014041.2-942s1c1
Sequence:CCGGGAAGTTTCTTTCAGGTGTAAACTCGAGTTTACACCTGAAAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-626s1c1
Sequence:CCGGCCTCTCAAGTGGTTACCTGTTCTCGAGAACAGGTAACCACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-470s1c1
Sequence:CCGGCAGATGTTTCAGGGAATTATTCTCGAGAATAATTCCCTGAAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-544s1c1
Sequence:CCGGGTGGACTGTCTATATAGTTATCTCGAGATAACTATATAGACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014041.2-653s1c1
Sequence:CCGGTCAAGCACAGACGACAAGAAACTCGAGTTTCTTGTCGTCTGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-942s21c1
Sequence:CCGGGAAGTTTCTTTCAGGTGTAAACTCGAGTTTACACCTGAAAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-470s21c1
Sequence:CCGGCAGATGTTTCAGGGAATTATTCTCGAGAATAATTCCCTGAAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-626s21c1
Sequence:CCGGCCTCTCAAGTGGTTACCTGTTCTCGAGAACAGGTAACCACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-544s21c1
Sequence:CCGGGTGGACTGTCTATATAGTTATCTCGAGATAACTATATAGACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014041
VALIDATED
SPCS1 MISSION shRNA shRNA Plasmid DNA
signal peptidase complex subunit 1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014041.2-942s1c1
Sequence:CCGGGAAGTTTCTTTCAGGTGTAAACTCGAGTTTACACCTGAAAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-626s1c1
Sequence:CCGGCCTCTCAAGTGGTTACCTGTTCTCGAGAACAGGTAACCACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-470s1c1
Sequence:CCGGCAGATGTTTCAGGGAATTATTCTCGAGAATAATTCCCTGAAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-544s1c1
Sequence:CCGGGTGGACTGTCTATATAGTTATCTCGAGATAACTATATAGACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014041.2-653s1c1
Sequence:CCGGTCAAGCACAGACGACAAGAAACTCGAGTTTCTTGTCGTCTGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-942s21c1
Sequence:CCGGGAAGTTTCTTTCAGGTGTAAACTCGAGTTTACACCTGAAAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-470s21c1
Sequence:CCGGCAGATGTTTCAGGGAATTATTCTCGAGAATAATTCCCTGAAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-626s21c1
Sequence:CCGGCCTCTCAAGTGGTTACCTGTTCTCGAGAACAGGTAACCACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-544s21c1
Sequence:CCGGGTGGACTGTCTATATAGTTATCTCGAGATAACTATATAGACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014041
VALIDATED
SPCS1 MISSION shRNA Lentiviral Transduction Particles
signal peptidase complex subunit 1 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014041.2-942s1c1
Sequence:CCGGGAAGTTTCTTTCAGGTGTAAACTCGAGTTTACACCTGAAAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-626s1c1
Sequence:CCGGCCTCTCAAGTGGTTACCTGTTCTCGAGAACAGGTAACCACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-470s1c1
Sequence:CCGGCAGATGTTTCAGGGAATTATTCTCGAGAATAATTCCCTGAAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014041.2-544s1c1
Sequence:CCGGGTGGACTGTCTATATAGTTATCTCGAGATAACTATATAGACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014041.2-653s1c1
Sequence:CCGGTCAAGCACAGACGACAAGAAACTCGAGTTTCTTGTCGTCTGTGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310602    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-942s21c1
Sequence:CCGGGAAGTTTCTTTCAGGTGTAAACTCGAGTTTACACCTGAAAGAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-470s21c1
Sequence:CCGGCAGATGTTTCAGGGAATTATTCTCGAGAATAATTCCCTGAAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-626s21c1
Sequence:CCGGCCTCTCAAGTGGTTACCTGTTCTCGAGAACAGGTAACCACTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014041.3-544s21c1
Sequence:CCGGGTGGACTGTCTATATAGTTATCTCGAGATAACTATATAGACAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026911
VALIDATED
SPCS1 MISSION shRNA Bacterial Glycerol Stock
signal peptidase complex subunit 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-362s1c1
Sequence:CCGGGTTCAAGACTTAGGCACAGAACTCGAGTTCTGTGCCTAAGTCTTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-271s1c1
Sequence:CCGGCTACATAGTTATGGCCGGATTCTCGAGAATCCGGCCATAACTATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-172s1c1
Sequence:CCGGGCAGAAACTAGCTGAACAGATCTCGAGATCTGTTCAGCTAGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-223s1c1
Sequence:CCGGAGTTGGGTTTATCTACGGGTACTCGAGTACCCGTAGATAAACCCAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-347s1c1
Sequence:CCGGCTAAAGTGGTTACCTGTTCAACTCGAGTTGAACAGGTAACCACTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-664s21c1
Sequence:CCGGGTTCAAGACTTAGGCACAGAACTCGAGTTCTGTGCCTAAGTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-838s21c1
Sequence:CCGGACAGCTGTGTCGAGATCTAATCTCGAGATTAGATCTCGACACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-474s21c1
Sequence:CCGGGCAGAAACTAGCTGAACAGATCTCGAGATCTGTTCAGCTAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-392s21c1
Sequence:CCGGGTCCGTTTCGTTGTCGGTATCCTCGAGGATACCGACAACGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026911
VALIDATED
SPCS1 MISSION shRNA shRNA Plasmid DNA
signal peptidase complex subunit 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-362s1c1
Sequence:CCGGGTTCAAGACTTAGGCACAGAACTCGAGTTCTGTGCCTAAGTCTTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-271s1c1
Sequence:CCGGCTACATAGTTATGGCCGGATTCTCGAGAATCCGGCCATAACTATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-172s1c1
Sequence:CCGGGCAGAAACTAGCTGAACAGATCTCGAGATCTGTTCAGCTAGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-223s1c1
Sequence:CCGGAGTTGGGTTTATCTACGGGTACTCGAGTACCCGTAGATAAACCCAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-347s1c1
Sequence:CCGGCTAAAGTGGTTACCTGTTCAACTCGAGTTGAACAGGTAACCACTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-664s21c1
Sequence:CCGGGTTCAAGACTTAGGCACAGAACTCGAGTTCTGTGCCTAAGTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-838s21c1
Sequence:CCGGACAGCTGTGTCGAGATCTAATCTCGAGATTAGATCTCGACACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-474s21c1
Sequence:CCGGGCAGAAACTAGCTGAACAGATCTCGAGATCTGTTCAGCTAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-392s21c1
Sequence:CCGGGTCCGTTTCGTTGTCGGTATCCTCGAGGATACCGACAACGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026911
VALIDATED
SPCS1 MISSION shRNA Lentiviral Transduction Particles
signal peptidase complex subunit 1 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-362s1c1
Sequence:CCGGGTTCAAGACTTAGGCACAGAACTCGAGTTCTGTGCCTAAGTCTTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-271s1c1
Sequence:CCGGCTACATAGTTATGGCCGGATTCTCGAGAATCCGGCCATAACTATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-172s1c1
Sequence:CCGGGCAGAAACTAGCTGAACAGATCTCGAGATCTGTTCAGCTAGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-223s1c1
Sequence:CCGGAGTTGGGTTTATCTACGGGTACTCGAGTACCCGTAGATAAACCCAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026911.1-347s1c1
Sequence:CCGGCTAAAGTGGTTACCTGTTCAACTCGAGTTGAACAGGTAACCACTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-664s21c1
Sequence:CCGGGTTCAAGACTTAGGCACAGAACTCGAGTTCTGTGCCTAAGTCTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-838s21c1
Sequence:CCGGACAGCTGTGTCGAGATCTAATCTCGAGATTAGATCTCGACACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-474s21c1
Sequence:CCGGGCAGAAACTAGCTGAACAGATCTCGAGATCTGTTCAGCTAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026911.3-392s21c1
Sequence:CCGGGTCCGTTTCGTTGTCGGTATCCTCGAGGATACCGACAACGAAACGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks