EMAIL THIS PAGE TO A FRIEND

SPCS2

signal peptidase complex subunit 2 homolog (S. cerevisiae)

Gene ID:
Mouse(66624) signal peptidase complex subunit 2 homolog (S. cerevisiae)
Rat(293142) signal peptidase complex subunit 2 homolog (S. cerevisiae)
naked mole-rat(101707075) signal peptidase complex subunit 2 homolog (S. cerevisiae)
domestic guinea pig(100733751) signal peptidase complex subunit 2 homolog (S. cerevisiae)
cow(786732) signal peptidase complex subunit 2 homolog (S. cerevisiae)
sheep(101107383) signal peptidase complex subunit 2 homolog (S. cerevisiae)
Zebrafish(541342) signal peptidase complex subunit 2 homolog (S. cerevisiae)
domestic cat(101092788) signal peptidase complex subunit 2 homolog (S. cerevisiae)
dog(404016) signal peptidase complex subunit 2 homolog (S. cerevisiae)
chicken(419056) signal peptidase complex subunit 2 homolog (S. cerevisiae)
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301704 Anti-SPCS2 affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA013386 Anti-SPCS2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014752 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014752 Rosetta Predictions human pricing
XM_001066421 Rosetta Predictions rat pricing
XM_214994 Rosetta Predictions rat pricing
NM_025668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173609 predicted 1012
2 SASI_Hs01_00173610 predicted 1000
3 SASI_Hs01_00173611 predicted 924
4 SASI_Hs01_00173614 predicted 924
5 SASI_Hs01_00173606 predicted 1129
6 SASI_Hs01_00173607 predicted 684
7 SASI_Hs02_00346218 predicted 1155
8 SASI_Hs01_00173612 predicted 1180
9 SASI_Hs01_00173613 predicted 1186
10 SASI_Hs02_00346219 predicted 803
11 SASI_Hs01_00173608 predicted 427
12 SASI_Hs01_00173615 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317401 predicted 1023
2 SASI_Rn02_00317402 predicted 371
3 SASI_Rn02_00317403 predicted 538
4 SASI_Rn02_00317404 predicted 385
5 SASI_Rn02_00317405 predicted 702
6 SASI_Rn02_00317406 predicted 1021
7 SASI_Rn02_00317407 predicted 690
8 SASI_Rn02_00317408 predicted 540
9 SASI_Rn02_00317409 predicted 709
10 SASI_Rn02_00317410 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375717 predicted 1017
2 SASI_Rn02_00375718 predicted 377
3 SASI_Rn02_00375719 predicted 545
4 SASI_Rn02_00375720 predicted 385
5 SASI_Rn02_00375721 predicted 703
6 SASI_Rn02_00375722 predicted 1023
7 SASI_Rn02_00375723 predicted 690
8 SASI_Rn02_00375724 predicted 542
9 SASI_Rn02_00375725 predicted 717
10 SASI_Rn02_00375726 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172034 predicted 747
2 SASI_Mm02_00328804 predicted 790
3 SASI_Mm01_00172036 predicted 973
4 SASI_Mm01_00172037 predicted 883
5 SASI_Mm02_00328805 predicted 748
6 SASI_Mm01_00172040 predicted 924
7 SASI_Mm02_00328806 predicted 832
8 SASI_Mm01_00172041 predicted 949
9 SASI_Mm02_00328807 predicted 234
10 SASI_Mm02_00328808 predicted 619
11 SASI_Mm01_00172035 predicted 395
12 SASI_Mm01_00172038 predicted 472
13 SASI_Mm01_00172039 predicted 459
14 SASI_Mm01_00172042 predicted 356
15 SASI_Mm01_00172043 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025668
VALIDATED
SPCS2 MISSION shRNA Bacterial Glycerol Stock
signal peptidase complex subunit 2 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-423s21c1
Sequence:CCGGCTTCCTTGTGGCCCACAGAAACTCGAGTTTCTGTGGGCCACAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025668.3-326s21c1
Sequence:CCGGTTCCTGAGTCCAAGCCAGTTTCTCGAGAAACTGGCTTGGACTCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-977s21c1
Sequence:CCGGGCAGCGTTTGAATGCTCAGTTCTCGAGAACTGAGCATTCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-126s21c1
Sequence:CCGGGATTGATGATAAGCCTGTAAACTCGAGTTTACAGGCTTATCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-565s21c1
Sequence:CCGGGCCGAGTTCACCAAGTCCATTCTCGAGAATGGACTTGGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025668.3-98s21c1
Sequence:CCGGGCCGCAGTGGTTTGTTGGATACTCGAGTATCCAACAAACCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-982s1c1
Sequence:CCGGGCAGCGTTTGAATGCTCAGTTCTCGAGAACTGAGCATTCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-299s1c1
Sequence:CCGGCGTGGCTTTGATTTGGGATTACTCGAGTAATCCCAAATCAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-570s1c1
Sequence:CCGGGCCGAGTTCACCAAGTCCATTCTCGAGAATGGACTTGGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-103s1c1
Sequence:CCGGGCCGCAGTGGTTTGTTGGATACTCGAGTATCCAACAAACCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-131s1c1
Sequence:CCGGGATTGATGATAAGCCTGTAAACTCGAGTTTACAGGCTTATCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025668
VALIDATED
SPCS2 MISSION shRNA shRNA Plasmid DNA
signal peptidase complex subunit 2 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-423s21c1
Sequence:CCGGCTTCCTTGTGGCCCACAGAAACTCGAGTTTCTGTGGGCCACAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025668.3-326s21c1
Sequence:CCGGTTCCTGAGTCCAAGCCAGTTTCTCGAGAAACTGGCTTGGACTCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-977s21c1
Sequence:CCGGGCAGCGTTTGAATGCTCAGTTCTCGAGAACTGAGCATTCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-126s21c1
Sequence:CCGGGATTGATGATAAGCCTGTAAACTCGAGTTTACAGGCTTATCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-565s21c1
Sequence:CCGGGCCGAGTTCACCAAGTCCATTCTCGAGAATGGACTTGGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025668.3-98s21c1
Sequence:CCGGGCCGCAGTGGTTTGTTGGATACTCGAGTATCCAACAAACCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-982s1c1
Sequence:CCGGGCAGCGTTTGAATGCTCAGTTCTCGAGAACTGAGCATTCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-299s1c1
Sequence:CCGGCGTGGCTTTGATTTGGGATTACTCGAGTAATCCCAAATCAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-570s1c1
Sequence:CCGGGCCGAGTTCACCAAGTCCATTCTCGAGAATGGACTTGGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-103s1c1
Sequence:CCGGGCCGCAGTGGTTTGTTGGATACTCGAGTATCCAACAAACCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-131s1c1
Sequence:CCGGGATTGATGATAAGCCTGTAAACTCGAGTTTACAGGCTTATCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025668
VALIDATED
SPCS2 MISSION shRNA Lentiviral Transduction Particles
signal peptidase complex subunit 2 homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-423s21c1
Sequence:CCGGCTTCCTTGTGGCCCACAGAAACTCGAGTTTCTGTGGGCCACAAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025668.3-326s21c1
Sequence:CCGGTTCCTGAGTCCAAGCCAGTTTCTCGAGAAACTGGCTTGGACTCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-977s21c1
Sequence:CCGGGCAGCGTTTGAATGCTCAGTTCTCGAGAACTGAGCATTCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-126s21c1
Sequence:CCGGGATTGATGATAAGCCTGTAAACTCGAGTTTACAGGCTTATCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025668.3-565s21c1
Sequence:CCGGGCCGAGTTCACCAAGTCCATTCTCGAGAATGGACTTGGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025668.3-98s21c1
Sequence:CCGGGCCGCAGTGGTTTGTTGGATACTCGAGTATCCAACAAACCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-982s1c1
Sequence:CCGGGCAGCGTTTGAATGCTCAGTTCTCGAGAACTGAGCATTCAAACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-299s1c1
Sequence:CCGGCGTGGCTTTGATTTGGGATTACTCGAGTAATCCCAAATCAAAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-570s1c1
Sequence:CCGGGCCGAGTTCACCAAGTCCATTCTCGAGAATGGACTTGGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-103s1c1
Sequence:CCGGGCCGCAGTGGTTTGTTGGATACTCGAGTATCCAACAAACCACTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025668.1-131s1c1
Sequence:CCGGGATTGATGATAAGCCTGTAAACTCGAGTTTACAGGCTTATCATCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014752
VALIDATED
SPCS2 MISSION shRNA Bacterial Glycerol Stock
signal peptidase complex subunit 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014752.2-851s21c1
Sequence:CCGGTTAGTCTATTCTGGGTAAATACTCGAGTATTTACCCAGAATAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-421s21c1
Sequence:CCGGCTGACCATTTATACCTCATATCTCGAGATATGAGGTATAAATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-382s21c1
Sequence:CCGGGCTTTGTGTGTCATATCCTATCTCGAGATAGGATATGACACACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-598s21c1
Sequence:CCGGGCCGAGTTCACAAAGTCCATTCTCGAGAATGGACTTTGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014752.1-557s1c1
Sequence:CCGGGCCGAGTTCACAAAGTCCATTCTCGAGAATGGACTTTGTGAACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014752.1-341s1c1
Sequence:CCGGGCTTTGTGTGTCATATCCTATCTCGAGATAGGATATGACACACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014752.1-380s1c1
Sequence:CCGGCTGACCATTTATACCTCATATCTCGAGATATGAGGTATAAATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014752.1-1047s1c1
Sequence:CCGGGCTGACTCTTAATTCCTATTTCTCGAGAAATAGGAATTAAGAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014752.1-626s1c1
Sequence:CCGGCCTGAAATATCCAGGCTCCATCTCGAGATGGAGCCTGGATATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014752
VALIDATED
SPCS2 MISSION shRNA shRNA Plasmid DNA
signal peptidase complex subunit 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014752.2-851s21c1
Sequence:CCGGTTAGTCTATTCTGGGTAAATACTCGAGTATTTACCCAGAATAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-421s21c1
Sequence:CCGGCTGACCATTTATACCTCATATCTCGAGATATGAGGTATAAATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-382s21c1
Sequence:CCGGGCTTTGTGTGTCATATCCTATCTCGAGATAGGATATGACACACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-598s21c1
Sequence:CCGGGCCGAGTTCACAAAGTCCATTCTCGAGAATGGACTTTGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014752.1-557s1c1
Sequence:CCGGGCCGAGTTCACAAAGTCCATTCTCGAGAATGGACTTTGTGAACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014752.1-341s1c1
Sequence:CCGGGCTTTGTGTGTCATATCCTATCTCGAGATAGGATATGACACACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014752.1-380s1c1
Sequence:CCGGCTGACCATTTATACCTCATATCTCGAGATATGAGGTATAAATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014752.1-1047s1c1
Sequence:CCGGGCTGACTCTTAATTCCTATTTCTCGAGAAATAGGAATTAAGAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014752.1-626s1c1
Sequence:CCGGCCTGAAATATCCAGGCTCCATCTCGAGATGGAGCCTGGATATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014752
VALIDATED
SPCS2 MISSION shRNA Lentiviral Transduction Particles
signal peptidase complex subunit 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315096    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014752.2-851s21c1
Sequence:CCGGTTAGTCTATTCTGGGTAAATACTCGAGTATTTACCCAGAATAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-421s21c1
Sequence:CCGGCTGACCATTTATACCTCATATCTCGAGATATGAGGTATAAATGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-382s21c1
Sequence:CCGGGCTTTGTGTGTCATATCCTATCTCGAGATAGGATATGACACACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014752.2-598s21c1
Sequence:CCGGGCCGAGTTCACAAAGTCCATTCTCGAGAATGGACTTTGTGAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014752.1-557s1c1
Sequence:CCGGGCCGAGTTCACAAAGTCCATTCTCGAGAATGGACTTTGTGAACTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014752.1-341s1c1
Sequence:CCGGGCTTTGTGTGTCATATCCTATCTCGAGATAGGATATGACACACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_014752.1-380s1c1
Sequence:CCGGCTGACCATTTATACCTCATATCTCGAGATATGAGGTATAAATGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005141    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014752.1-1047s1c1
Sequence:CCGGGCTGACTCTTAATTCCTATTTCTCGAGAAATAGGAATTAAGAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014752.1-626s1c1
Sequence:CCGGCCTGAAATATCCAGGCTCCATCTCGAGATGGAGCCTGGATATTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks