EMAIL THIS PAGE TO A FRIEND

SPCS3

signal peptidase complex subunit 3 homolog (S. cerevisiae)

Synonyms: PRO3567 SPC22/23 SPC3 YLR066W
UniProtKB ID: P61009, P12280, Q9H0S7
Gene ID:
Mouse(76687) signal peptidase complex subunit 3 homolog (S. cerevisiae)
Rat(680782) signal peptidase complex subunit 3 homolog (S. cerevisiae)
Zebrafish(405884) signal peptidase complex subunit 3 homolog (S. cerevisiae)
domestic cat(101085116) signal peptidase complex subunit 3 homolog (S. cerevisiae)
chicken(396234) signal peptidase complex subunit 3 homolog (S. cerevisiae)
dog(404005) signal peptidase complex subunit 3 homolog (S. cerevisiae)
cow(100337141) signal peptidase complex subunit 3 homolog (S. cerevisiae)
sheep(101105386) signal peptidase complex subunit 3 homolog (S. cerevisiae)
cow(767917) signal peptidase complex subunit 3 homolog (S. cerevisiae)
domestic guinea pig(100724749) signal peptidase complex subunit 3 homolog (S. cerevisiae)
naked mole-rat(101718459) signal peptidase complex subunit 3 homolog (S. cerevisiae)
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU188951 MISSION® esiRNA esiRNA targeting mouse Spcs3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021928 Rosetta Predictions human pricing
XM_001058844 Rosetta Predictions rat pricing
NM_029701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355211 predicted 400
2 SASI_Hs01_00040170 predicted 314
3 SASI_Hs02_00355212 predicted 390
4 SASI_Hs02_00355213 predicted 348
5 SASI_Hs02_00355214 predicted 432
6 SASI_Hs02_00355215 predicted 434
7 SASI_Hs02_00355216 predicted 402
8 SASI_Hs01_00040178 predicted 391
9 SASI_Hs02_00355217 predicted 283
10 SASI_Hs02_00355218 predicted 307
11 SASI_Hs01_00040169 predicted 510
12 SASI_Hs01_00040171 predicted 514
13 SASI_Hs01_00040172 predicted 290
14 SASI_Hs01_00040173 predicted 1105
15 SASI_Hs01_00040174 predicted 352
16 SASI_Hs01_00040175 predicted 1019
17 SASI_Hs01_00040176 predicted 1046
18 SASI_Hs01_00040177 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058844 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291037 predicted 290
2 SASI_Rn02_00291038 predicted 1132
3 SASI_Rn02_00291039 predicted 318
4 SASI_Rn02_00291040 predicted 300
5 SASI_Rn02_00291041 predicted 507
6 SASI_Rn02_00291042 predicted 332
7 SASI_Rn02_00291043 predicted 447
8 SASI_Rn02_00291044 predicted 350
9 SASI_Rn02_00291045 predicted 415
10 SASI_Rn02_00291046 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335742 predicted 303
2 SASI_Mm02_00335743 predicted 1009
3 SASI_Mm02_00335744 predicted 312
4 SASI_Mm02_00335745 predicted 942
5 SASI_Mm02_00335746 predicted 271
6 SASI_Mm02_00335747 predicted 1089
7 SASI_Mm02_00335748 predicted 935
8 SASI_Mm02_00335749 predicted 958
9 SASI_Mm02_00335750 predicted 1036
10 SASI_Mm02_00335751 predicted 961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021928
VALIDATED
SPCS3 MISSION shRNA Bacterial Glycerol Stock
signal peptidase complex subunit 3 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-1387s1c1
Sequence:CCGGGCGTTGCCATTGAAAGTTAAACTCGAGTTTAACTTTCAATGGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021928.1-559s1c1
Sequence:CCGGACGTCGTACCAAATGCTGGAACTCGAGTTCCAGCATTTGGTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-297s1c1
Sequence:CCGGGATCTGGGATTTATCACATTTCTCGAGAAATGTGATAAATCCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-560s1c1
Sequence:CCGGCGTCGTACCAAATGCTGGAATCTCGAGATTCCAGCATTTGGTACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-408s1c1
Sequence:CCGGGCTCTGAACCAAGTTGTCCTACTCGAGTAGGACAACTTGGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021928.3-482s21c1
Sequence:CCGGATCCGAAGCTGCTGCTGAAAGCTCGAGCTTTCAGCAGCAGCTTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021928.3-1034s21c1
Sequence:CCGGGTGCCTGTAGAGTCATAATAACTCGAGTTATTATGACTCTACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021928.3-404s21c1
Sequence:CCGGTATCAGCAGAATATTCAACAACTCGAGTTGTTGAATATTCTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021928
VALIDATED
SPCS3 MISSION shRNA shRNA Plasmid DNA
signal peptidase complex subunit 3 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-1387s1c1
Sequence:CCGGGCGTTGCCATTGAAAGTTAAACTCGAGTTTAACTTTCAATGGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021928.1-559s1c1
Sequence:CCGGACGTCGTACCAAATGCTGGAACTCGAGTTCCAGCATTTGGTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-297s1c1
Sequence:CCGGGATCTGGGATTTATCACATTTCTCGAGAAATGTGATAAATCCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-560s1c1
Sequence:CCGGCGTCGTACCAAATGCTGGAATCTCGAGATTCCAGCATTTGGTACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-408s1c1
Sequence:CCGGGCTCTGAACCAAGTTGTCCTACTCGAGTAGGACAACTTGGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021928.3-482s21c1
Sequence:CCGGATCCGAAGCTGCTGCTGAAAGCTCGAGCTTTCAGCAGCAGCTTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021928.3-1034s21c1
Sequence:CCGGGTGCCTGTAGAGTCATAATAACTCGAGTTATTATGACTCTACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021928.3-404s21c1
Sequence:CCGGTATCAGCAGAATATTCAACAACTCGAGTTGTTGAATATTCTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021928
VALIDATED
SPCS3 MISSION shRNA Lentiviral Transduction Particles
signal peptidase complex subunit 3 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-1387s1c1
Sequence:CCGGGCGTTGCCATTGAAAGTTAAACTCGAGTTTAACTTTCAATGGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021928.1-559s1c1
Sequence:CCGGACGTCGTACCAAATGCTGGAACTCGAGTTCCAGCATTTGGTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-297s1c1
Sequence:CCGGGATCTGGGATTTATCACATTTCTCGAGAAATGTGATAAATCCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-560s1c1
Sequence:CCGGCGTCGTACCAAATGCTGGAATCTCGAGATTCCAGCATTTGGTACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021928.1-408s1c1
Sequence:CCGGGCTCTGAACCAAGTTGTCCTACTCGAGTAGGACAACTTGGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021928.3-482s21c1
Sequence:CCGGATCCGAAGCTGCTGCTGAAAGCTCGAGCTTTCAGCAGCAGCTTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021928.3-1034s21c1
Sequence:CCGGGTGCCTGTAGAGTCATAATAACTCGAGTTATTATGACTCTACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021928.3-404s21c1
Sequence:CCGGTATCAGCAGAATATTCAACAACTCGAGTTGTTGAATATTCTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029701
VALIDATED
SPCS3 MISSION shRNA Bacterial Glycerol Stock
signal peptidase complex subunit 3 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-329s21c1
Sequence:CCGGATTGGAATGTTAAGCAGTTATCTCGAGATAACTGCTTAACATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-277s21c1
Sequence:CCGGGACCTGGGATTCATCACATTTCTCGAGAAATGTGATGAATCCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-602s21c1
Sequence:CCGGTTCCAGATACATACGAAATAACTCGAGTTATTTCGTATGTATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-894s21c1
Sequence:CCGGGTAGGGTTGAAACACGTATTTCTCGAGAAATACGTGTTTCAACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-219s21c1
Sequence:CCGGCGTCTCGCGGATCATGCTAAACTCGAGTTTAGCATGATCCGCGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029701
VALIDATED
SPCS3 MISSION shRNA shRNA Plasmid DNA
signal peptidase complex subunit 3 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-329s21c1
Sequence:CCGGATTGGAATGTTAAGCAGTTATCTCGAGATAACTGCTTAACATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-277s21c1
Sequence:CCGGGACCTGGGATTCATCACATTTCTCGAGAAATGTGATGAATCCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-602s21c1
Sequence:CCGGTTCCAGATACATACGAAATAACTCGAGTTATTTCGTATGTATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-894s21c1
Sequence:CCGGGTAGGGTTGAAACACGTATTTCTCGAGAAATACGTGTTTCAACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-219s21c1
Sequence:CCGGCGTCTCGCGGATCATGCTAAACTCGAGTTTAGCATGATCCGCGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029701
VALIDATED
SPCS3 MISSION shRNA Lentiviral Transduction Particles
signal peptidase complex subunit 3 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-329s21c1
Sequence:CCGGATTGGAATGTTAAGCAGTTATCTCGAGATAACTGCTTAACATTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-277s21c1
Sequence:CCGGGACCTGGGATTCATCACATTTCTCGAGAAATGTGATGAATCCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-602s21c1
Sequence:CCGGTTCCAGATACATACGAAATAACTCGAGTTATTTCGTATGTATCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254014    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-894s21c1
Sequence:CCGGGTAGGGTTGAAACACGTATTTCTCGAGAAATACGTGTTTCAACCCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029701.1-219s21c1
Sequence:CCGGCGTCTCGCGGATCATGCTAAACTCGAGTTTAGCATGATCCGCGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks