EMAIL THIS PAGE TO A FRIEND

SPDEF

SAM pointed domain containing ETS transcription factor

Synonyms: PDEF RP11-375E1__A.3 bA375E1.3
UniProtKB ID: O95238, B4DWH8, F5H778
Gene ID:
Human(25803) Summary: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(30051) SAM pointed domain containing ets transcription factor
Rat(689210) SAM pointed domain containing ets transcription factor
chicken(428271) SAM pointed domain containing ets transcription factor
dog(481751) SAM pointed domain containing ets transcription factor
domestic cat(101096315) SAM pointed domain containing ets transcription factor
naked mole-rat(101698462) SAM pointed domain containing ets transcription factor
domestic guinea pig(100726493) SAM pointed domain containing ets transcription factor
cow(497620) SAM pointed domain containing ets transcription factor
sheep(101120201) SAM pointed domain containing ets transcription factor
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012391 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012391 Rosetta Predictions human pricing
NM_001109530 Rosetta Predictions rat pricing
NM_013891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124042 predicted 1328
2 SASI_Hs02_00344198 predicted 1211
3 SASI_Hs01_00124043 predicted 577
4 SASI_Hs01_00124044 predicted 1196
5 SASI_Hs01_00124045 predicted 1198
6 SASI_Hs01_00124046 predicted 1168
7 SASI_Hs01_00124047 predicted 1159
8 SASI_Hs02_00344199 predicted 791
9 SASI_Hs01_00124048 predicted 777
10 SASI_Hs01_00124049 predicted 1164
11 SASI_Hs01_00124050 predicted 888
12 SASI_Hs01_00124051 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249309 predicted 1082
2 SASI_Rn02_00249310 predicted 741
3 SASI_Rn02_00249311 predicted 490
4 SASI_Rn02_00249312 predicted 1409
5 SASI_Rn02_00249313 predicted 1235
6 SASI_Rn02_00249314 predicted 1088
7 SASI_Rn02_00249315 predicted 1212
8 SASI_Rn02_00249316 predicted 1233
9 SASI_Rn02_00249317 predicted 948
10 SASI_Rn02_00249318 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090936 predicted 1491
2 SASI_Mm01_00090937 predicted 769
3 SASI_Mm01_00090938 predicted 511
4 SASI_Mm02_00322947 predicted 1365
5 SASI_Mm01_00090940 predicted 1305
6 SASI_Mm01_00090941 predicted 585
7 SASI_Mm01_00090942 predicted 1482
8 SASI_Mm01_00090943 predicted 1106
9 SASI_Mm01_00090944 predicted 1339
10 SASI_Mm01_00090945 predicted 1096
11 SASI_Mm01_00090939 predicted 1222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013891
SPDEF MISSION shRNA Bacterial Glycerol Stock
SAM pointed domain containing ETS transcription factor
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013891.4-1549s21c1
Sequence:CCGGCATGAGCTCTCTGGGTCATACCTCGAGGTATGACCCAGAGAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013891.4-1197s21c1
Sequence:CCGGTTCATCCGCTGGCTCAACAAGCTCGAGCTTGTTGAGCCAGCGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013891.4-1583s21c1
Sequence:CCGGAGATCGAGGGAGCTAGGATTGCTCGAGCAATCCTAGCTCCCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013891.2-1618s1c1
Sequence:CCGGCCGGGCTTGGACTGTGGAATTCTCGAGAATTCCACAGTCCAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-1147s1c1
Sequence:CCGGCTGTGGCAGTTCCTGAAAGAACTCGAGTTCTTTCAGGAACTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-603s1c1
Sequence:CCGGCCTCTCTTACTTTAACATGTACTCGAGTACATGTTAAAGTAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-595s1c1
Sequence:CCGGGCTTTCTACCTCTCTTACTTTCTCGAGAAAGTAAGAGAGGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-1325s1c1
Sequence:CCGGGCCAGTATTACAAGAAGGGCACTCGAGTGCCCTTCTTGTAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013891
SPDEF MISSION shRNA shRNA Plasmid DNA
SAM pointed domain containing ETS transcription factor
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013891.4-1549s21c1
Sequence:CCGGCATGAGCTCTCTGGGTCATACCTCGAGGTATGACCCAGAGAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013891.4-1197s21c1
Sequence:CCGGTTCATCCGCTGGCTCAACAAGCTCGAGCTTGTTGAGCCAGCGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013891.4-1583s21c1
Sequence:CCGGAGATCGAGGGAGCTAGGATTGCTCGAGCAATCCTAGCTCCCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013891.2-1618s1c1
Sequence:CCGGCCGGGCTTGGACTGTGGAATTCTCGAGAATTCCACAGTCCAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-1147s1c1
Sequence:CCGGCTGTGGCAGTTCCTGAAAGAACTCGAGTTCTTTCAGGAACTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-603s1c1
Sequence:CCGGCCTCTCTTACTTTAACATGTACTCGAGTACATGTTAAAGTAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-595s1c1
Sequence:CCGGGCTTTCTACCTCTCTTACTTTCTCGAGAAAGTAAGAGAGGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-1325s1c1
Sequence:CCGGGCCAGTATTACAAGAAGGGCACTCGAGTGCCCTTCTTGTAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013891
SPDEF MISSION shRNA Lentiviral Transduction Particles
SAM pointed domain containing ETS transcription factor
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013891.4-1549s21c1
Sequence:CCGGCATGAGCTCTCTGGGTCATACCTCGAGGTATGACCCAGAGAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013891.4-1197s21c1
Sequence:CCGGTTCATCCGCTGGCTCAACAAGCTCGAGCTTGTTGAGCCAGCGGATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013891.4-1583s21c1
Sequence:CCGGAGATCGAGGGAGCTAGGATTGCTCGAGCAATCCTAGCTCCCTCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013891.2-1618s1c1
Sequence:CCGGCCGGGCTTGGACTGTGGAATTCTCGAGAATTCCACAGTCCAAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-1147s1c1
Sequence:CCGGCTGTGGCAGTTCCTGAAAGAACTCGAGTTCTTTCAGGAACTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-603s1c1
Sequence:CCGGCCTCTCTTACTTTAACATGTACTCGAGTACATGTTAAAGTAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-595s1c1
Sequence:CCGGGCTTTCTACCTCTCTTACTTTCTCGAGAAAGTAAGAGAGGTAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013891.2-1325s1c1
Sequence:CCGGGCCAGTATTACAAGAAGGGCACTCGAGTGCCCTTCTTGTAATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012391
VALIDATED
SPDEF MISSION shRNA Bacterial Glycerol Stock
SAM pointed domain containing ETS transcription factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-893s21c1
Sequence:CCGGCTGTGGACAGAGCACCAATACCTCGAGGTATTGGTGCTCTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-589s21c1
Sequence:CCGGCTACCTCTCCTACTTTGACATCTCGAGATGTCAAAGTAGGAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-1345s21c1
Sequence:CCGGCCAGTATTACAAGAAGGGCATCTCGAGATGCCCTTCTTGTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-1053s21c1
Sequence:CCGGCCTGGATGAAAGAGCGGACTTCTCGAGAAGTCCGCTCTTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012391.1-1724s21c1
Sequence:CCGGAGAAGGGCAGTGACTCGACAACTCGAGTTGTCGAGTCACTGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-1345s1c1
Sequence:CCGGCCAGTATTACAAGAAGGGCATCTCGAGATGCCCTTCTTGTAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-589s1c1
Sequence:CCGGCTACCTCTCCTACTTTGACATCTCGAGATGTCAAAGTAGGAGAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-1053s1c1
Sequence:CCGGCCTGGATGAAAGAGCGGACTTCTCGAGAAGTCCGCTCTTTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012391
VALIDATED
SPDEF MISSION shRNA shRNA Plasmid DNA
SAM pointed domain containing ETS transcription factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-893s21c1
Sequence:CCGGCTGTGGACAGAGCACCAATACCTCGAGGTATTGGTGCTCTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-589s21c1
Sequence:CCGGCTACCTCTCCTACTTTGACATCTCGAGATGTCAAAGTAGGAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-1345s21c1
Sequence:CCGGCCAGTATTACAAGAAGGGCATCTCGAGATGCCCTTCTTGTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-1053s21c1
Sequence:CCGGCCTGGATGAAAGAGCGGACTTCTCGAGAAGTCCGCTCTTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012391.1-1724s21c1
Sequence:CCGGAGAAGGGCAGTGACTCGACAACTCGAGTTGTCGAGTCACTGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-1345s1c1
Sequence:CCGGCCAGTATTACAAGAAGGGCATCTCGAGATGCCCTTCTTGTAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-589s1c1
Sequence:CCGGCTACCTCTCCTACTTTGACATCTCGAGATGTCAAAGTAGGAGAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-1053s1c1
Sequence:CCGGCCTGGATGAAAGAGCGGACTTCTCGAGAAGTCCGCTCTTTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012391
VALIDATED
SPDEF MISSION shRNA Lentiviral Transduction Particles
SAM pointed domain containing ETS transcription factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-893s21c1
Sequence:CCGGCTGTGGACAGAGCACCAATACCTCGAGGTATTGGTGCTCTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-589s21c1
Sequence:CCGGCTACCTCTCCTACTTTGACATCTCGAGATGTCAAAGTAGGAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-1345s21c1
Sequence:CCGGCCAGTATTACAAGAAGGGCATCTCGAGATGCCCTTCTTGTAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012391.1-1053s21c1
Sequence:CCGGCCTGGATGAAAGAGCGGACTTCTCGAGAAGTCCGCTCTTTCATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012391.1-1724s21c1
Sequence:CCGGAGAAGGGCAGTGACTCGACAACTCGAGTTGTCGAGTCACTGCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-1345s1c1
Sequence:CCGGCCAGTATTACAAGAAGGGCATCTCGAGATGCCCTTCTTGTAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-589s1c1
Sequence:CCGGCTACCTCTCCTACTTTGACATCTCGAGATGTCAAAGTAGGAGAGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012391.1-1053s1c1
Sequence:CCGGCCTGGATGAAAGAGCGGACTTCTCGAGAAGTCCGCTCTTTCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks