EMAIL THIS PAGE TO A FRIEND

SPDL1

spindle apparatus coiled-coil protein 1

Synonyms: CCDC99
UniProtKB ID: Q96EA4, C9JS47, Q8TEC8, Q9HD44, Q9NX97
Gene ID:
Mouse(70385) spindle apparatus coiled-coil protein 1
Rat(303037) spindle apparatus coiled-coil protein 1
dog(479295) spindle apparatus coiled-coil protein 1
cow(515158) coiled-coil domain containing 99
sheep(101104782) spindle apparatus coiled-coil protein 1
domestic guinea pig(100716094) spindle apparatus coiled-coil protein 1
naked mole-rat(101707996) spindle apparatus coiled-coil protein 1
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017785 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017785 Rosetta Predictions human pricing
NM_001034138 Rosetta Predictions rat pricing
NM_027411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350643 predicted 1100
2 SASI_Hs02_00350644 predicted 1083
3 SASI_Hs01_00139354 predicted 1478
4 SASI_Hs02_00350645 predicted 742
5 SASI_Hs02_00350646 predicted 2034
6 SASI_Hs01_00139355 predicted 954
7 SASI_Hs01_00139356 predicted 2133
8 SASI_Hs02_00350647 predicted 547
9 SASI_Hs01_00139357 predicted 1386
10 SASI_Hs01_00139358 predicted 851
11 SASI_Hs01_00139353 predicted 969
12 SASI_Hs01_00139359 predicted 1237
13 SASI_Hs01_00139360 predicted 1428
14 SASI_Hs01_00139361 predicted 376
15 SASI_Hs01_00139362 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043624 predicted 1088
2 SASI_Rn01_00043625 predicted 1833
3 SASI_Rn01_00043626 predicted 898
4 SASI_Rn01_00043628 predicted 703
5 SASI_Rn01_00043629 predicted 1797
6 SASI_Rn02_00203989 predicted 1573
7 SASI_Rn01_00043630 predicted 796
8 SASI_Rn01_00043631 predicted 2007
9 SASI_Rn02_00203990 predicted 1112
10 SASI_Rn02_00203991 predicted 466
11 SASI_Rn01_00043627 predicted 1165
12 SASI_Rn01_00043632 predicted 1426
13 SASI_Rn01_00043633 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189614 predicted 1401
2 SASI_Mm01_00189616 predicted 751
3 SASI_Mm01_00189617 predicted 720
4 SASI_Mm01_00189619 predicted 700
5 SASI_Mm01_00189620 predicted 1189
6 SASI_Mm01_00189622 predicted 1925
7 SASI_Mm01_00189623 predicted 1264
8 SASI_Mm02_00332146 predicted 968
9 SASI_Mm02_00332147 predicted 1886
10 SASI_Mm02_00332148 predicted 1141
11 SASI_Mm01_00189615 predicted 968
12 SASI_Mm01_00189618 predicted 1919
13 SASI_Mm01_00189621 predicted 1205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017785
VALIDATED
SPDL1 MISSION shRNA Bacterial Glycerol Stock
spindle apparatus coiled-coil protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-1812s1c1
Sequence:CCGGCCAGGTTAGCTGCTGAATCAACTCGAGTTGATTCAGCAGCTAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017785.2-2096s1c1
Sequence:CCGGCCTTTGACCAAGTGTTCAGAACTCGAGTTCTGAACACTTGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2280s1c1
Sequence:CCGGGCCATGTATTTGAGAATGCTTCTCGAGAAGCATTCTCAAATACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-830s1c1
Sequence:CCGGGCTCGTGTAGCAAATCAAGATCTCGAGATCTTGATTTGCTACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-375s1c1
Sequence:CCGGGCTGCGAATGTGAAGCTATTACTCGAGTAATAGCTTCACATTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-1517s1c1
Sequence:CCGGGTGGATATAACCACCGCTAAACTCGAGTTTAGCGGTGGTTATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-212s1c1
Sequence:CCGGGCTGCACAGTATGGTTTACAACTCGAGTTGTAAACCATACTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2103s1c1
Sequence:CCGGCCAAGTGTTCAGAATTTGCTTCTCGAGAAGCAAATTCTGAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2048s1c1
Sequence:CCGGCCTTCTGGGTTATTTACTCATCTCGAGATGAGTAAATAACCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017785.4-964s21c1
Sequence:CCGGGCTCGTGTAGCAAATCAAGATCTCGAGATCTTGATTTGCTACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017785.4-2230s21c1
Sequence:CCGGCCTTTGACCAAGTGTTCAGAACTCGAGTTCTGAACACTTGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017785.4-509s21c1
Sequence:CCGGGCTGCGAATGTGAAGCTATTACTCGAGTAATAGCTTCACATTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017785
VALIDATED
SPDL1 MISSION shRNA shRNA Plasmid DNA
spindle apparatus coiled-coil protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-1812s1c1
Sequence:CCGGCCAGGTTAGCTGCTGAATCAACTCGAGTTGATTCAGCAGCTAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017785.2-2096s1c1
Sequence:CCGGCCTTTGACCAAGTGTTCAGAACTCGAGTTCTGAACACTTGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2280s1c1
Sequence:CCGGGCCATGTATTTGAGAATGCTTCTCGAGAAGCATTCTCAAATACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-830s1c1
Sequence:CCGGGCTCGTGTAGCAAATCAAGATCTCGAGATCTTGATTTGCTACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-375s1c1
Sequence:CCGGGCTGCGAATGTGAAGCTATTACTCGAGTAATAGCTTCACATTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-1517s1c1
Sequence:CCGGGTGGATATAACCACCGCTAAACTCGAGTTTAGCGGTGGTTATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-212s1c1
Sequence:CCGGGCTGCACAGTATGGTTTACAACTCGAGTTGTAAACCATACTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2103s1c1
Sequence:CCGGCCAAGTGTTCAGAATTTGCTTCTCGAGAAGCAAATTCTGAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2048s1c1
Sequence:CCGGCCTTCTGGGTTATTTACTCATCTCGAGATGAGTAAATAACCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017785.4-964s21c1
Sequence:CCGGGCTCGTGTAGCAAATCAAGATCTCGAGATCTTGATTTGCTACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017785.4-2230s21c1
Sequence:CCGGCCTTTGACCAAGTGTTCAGAACTCGAGTTCTGAACACTTGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017785.4-509s21c1
Sequence:CCGGGCTGCGAATGTGAAGCTATTACTCGAGTAATAGCTTCACATTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017785
VALIDATED
SPDL1 MISSION shRNA Lentiviral Transduction Particles
spindle apparatus coiled-coil protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-1812s1c1
Sequence:CCGGCCAGGTTAGCTGCTGAATCAACTCGAGTTGATTCAGCAGCTAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017785.2-2096s1c1
Sequence:CCGGCCTTTGACCAAGTGTTCAGAACTCGAGTTCTGAACACTTGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159642    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2280s1c1
Sequence:CCGGGCCATGTATTTGAGAATGCTTCTCGAGAAGCATTCTCAAATACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-830s1c1
Sequence:CCGGGCTCGTGTAGCAAATCAAGATCTCGAGATCTTGATTTGCTACACGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-375s1c1
Sequence:CCGGGCTGCGAATGTGAAGCTATTACTCGAGTAATAGCTTCACATTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-1517s1c1
Sequence:CCGGGTGGATATAACCACCGCTAAACTCGAGTTTAGCGGTGGTTATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017785.2-212s1c1
Sequence:CCGGGCTGCACAGTATGGTTTACAACTCGAGTTGTAAACCATACTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135059    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2103s1c1
Sequence:CCGGCCAAGTGTTCAGAATTTGCTTCTCGAGAAGCAAATTCTGAACACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135058    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017785.2-2048s1c1
Sequence:CCGGCCTTCTGGGTTATTTACTCATCTCGAGATGAGTAAATAACCCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017785.4-964s21c1
Sequence:CCGGGCTCGTGTAGCAAATCAAGATCTCGAGATCTTGATTTGCTACACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017785.4-2230s21c1
Sequence:CCGGCCTTTGACCAAGTGTTCAGAACTCGAGTTCTGAACACTTGGTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017785.4-509s21c1
Sequence:CCGGGCTGCGAATGTGAAGCTATTACTCGAGTAATAGCTTCACATTCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027411
VALIDATED
SPDL1 MISSION shRNA Bacterial Glycerol Stock
spindle apparatus coiled-coil protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1783s1c1
Sequence:CCGGGCCAACATTGAGGTCTTACATCTCGAGATGTAAGACCTCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-2183s1c1
Sequence:CCGGCAGAAGAGAATGGGAGAATTTCTCGAGAAATTCTCCCATTCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1117s1c1
Sequence:CCGGGCCATGATAGAACAGAAGAATCTCGAGATTCTTCTGTTCTATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027411.1-211s1c1
Sequence:CCGGCGACTGAAAGCTGCACACTATCTCGAGATAGTGTGCAGCTTTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1486s1c1
Sequence:CCGGGAGAGAATTGAAGTACCTGTACTCGAGTACAGGTACTTCAATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1503s21c1
Sequence:CCGGGAGAGAATTGAAGTACCTGTACTCGAGTACAGGTACTTCAATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1134s21c1
Sequence:CCGGGCCATGATAGAACAGAAGAATCTCGAGATTCTTCTGTTCTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027411.2-2200s21c1
Sequence:CCGGCAGAAGAGAATGGGAGAATTTCTCGAGAAATTCTCCCATTCTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1800s21c1
Sequence:CCGGGCCAACATTGAGGTCTTACATCTCGAGATGTAAGACCTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027411
VALIDATED
SPDL1 MISSION shRNA shRNA Plasmid DNA
spindle apparatus coiled-coil protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1783s1c1
Sequence:CCGGGCCAACATTGAGGTCTTACATCTCGAGATGTAAGACCTCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-2183s1c1
Sequence:CCGGCAGAAGAGAATGGGAGAATTTCTCGAGAAATTCTCCCATTCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1117s1c1
Sequence:CCGGGCCATGATAGAACAGAAGAATCTCGAGATTCTTCTGTTCTATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027411.1-211s1c1
Sequence:CCGGCGACTGAAAGCTGCACACTATCTCGAGATAGTGTGCAGCTTTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1486s1c1
Sequence:CCGGGAGAGAATTGAAGTACCTGTACTCGAGTACAGGTACTTCAATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1503s21c1
Sequence:CCGGGAGAGAATTGAAGTACCTGTACTCGAGTACAGGTACTTCAATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1134s21c1
Sequence:CCGGGCCATGATAGAACAGAAGAATCTCGAGATTCTTCTGTTCTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027411.2-2200s21c1
Sequence:CCGGCAGAAGAGAATGGGAGAATTTCTCGAGAAATTCTCCCATTCTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1800s21c1
Sequence:CCGGGCCAACATTGAGGTCTTACATCTCGAGATGTAAGACCTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027411
VALIDATED
SPDL1 MISSION shRNA Lentiviral Transduction Particles
spindle apparatus coiled-coil protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1783s1c1
Sequence:CCGGGCCAACATTGAGGTCTTACATCTCGAGATGTAAGACCTCAATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-2183s1c1
Sequence:CCGGCAGAAGAGAATGGGAGAATTTCTCGAGAAATTCTCCCATTCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1117s1c1
Sequence:CCGGGCCATGATAGAACAGAAGAATCTCGAGATTCTTCTGTTCTATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027411.1-211s1c1
Sequence:CCGGCGACTGAAAGCTGCACACTATCTCGAGATAGTGTGCAGCTTTCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027411.1-1486s1c1
Sequence:CCGGGAGAGAATTGAAGTACCTGTACTCGAGTACAGGTACTTCAATTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1503s21c1
Sequence:CCGGGAGAGAATTGAAGTACCTGTACTCGAGTACAGGTACTTCAATTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1134s21c1
Sequence:CCGGGCCATGATAGAACAGAAGAATCTCGAGATTCTTCTGTTCTATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027411.2-2200s21c1
Sequence:CCGGCAGAAGAGAATGGGAGAATTTCTCGAGAAATTCTCCCATTCTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027411.2-1800s21c1
Sequence:CCGGGCCAACATTGAGGTCTTACATCTCGAGATGTAAGACCTCAATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks