EMAIL THIS PAGE TO A FRIEND

SPDYA

speedy/RINGO cell cycle regulator family member A

Synonyms: RINGO3 RINGOA SPDY1 SPY1
UniProtKB ID: Q5MJ70, Q53R05, Q5MJ69
Gene ID:
Mouse(70891) speedy homolog A (Xenopus laevis)
Rat(192209) speedy/RINGO cell cycle regulator family member A
Zebrafish(100005885) speedy homolog A (Xenopus laevis)
chicken(101668613) speedy/RINGO cell cycle regulator family member A
chicken(421293) speedy homolog A (Xenopus laevis)
chicken(101748777) speedy/RINGO cell cycle regulator family member A
domestic cat(101092678) speedy homolog A (Xenopus laevis)
dog(100688090) speedy homolog A (Xenopus laevis)
naked mole-rat(101698914) speedy/RINGO cell cycle regulator family member A
domestic guinea pig(100730650) speedy/RINGO cell cycle regulator family member A
cow(616408) speedy homolog A (Xenopus laevis)
sheep(101123454) speedy homolog A (Xenopus laevis)
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001480221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001480221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001480221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU072611 MISSION® esiRNA esiRNA targeting mouse Spdya (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008779 Rosetta Predictions human pricing
NM_182756 Rosetta Predictions human pricing
NM_138855 Rosetta Predictions rat pricing
XM_001480221 Rosetta Predictions mouse pricing
XM_001481181 Rosetta Predictions mouse pricing
XM_128768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116630 predicted 394
2 SASI_Hs01_00116631 predicted 345
3 SASI_Hs01_00116632 predicted 369
4 SASI_Hs01_00116633 predicted 598
5 SASI_Hs01_00116634 predicted 278
6 SASI_Hs01_00116635 predicted 314
7 SASI_Hs02_00305569 predicted 560
8 SASI_Hs01_00116636 predicted 584
9 SASI_Hs01_00116637 predicted 202
10 SASI_Hs01_00116639 predicted 347
11 SASI_Hs01_00116638 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070953 predicted 567
2 SASI_Hs01_00070954 predicted 511
3 SASI_Hs01_00070955 predicted 534
4 SASI_Hs01_00070956 predicted 774
5 SASI_Hs01_00070957 predicted 450
6 SASI_Hs01_00070958 predicted 490
7 SASI_Hs02_00370913 predicted 727
8 SASI_Hs01_00070959 predicted 757
9 SASI_Hs01_00070960 predicted 380
10 SASI_Hs01_00070962 predicted 520
11 SASI_Hs01_00070961 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138855 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113781 predicted 1096
2 SASI_Rn01_00113782 predicted 989
3 SASI_Rn01_00113783 predicted 545
4 SASI_Rn01_00113784 predicted 893
5 SASI_Rn01_00113785 predicted 490
6 SASI_Rn01_00113786 predicted 861
7 SASI_Rn01_00113787 predicted 1113
8 SASI_Rn01_00113788 predicted 888
9 SASI_Rn01_00113790 predicted 827
10 SASI_Rn02_00268251 predicted 860
11 SASI_Rn01_00113789 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416000 predicted 559
2 SASI_Mm02_00416001 predicted 507
3 SASI_Mm02_00416002 predicted 468
4 SASI_Mm02_00416003 predicted 445
5 SASI_Mm02_00416004 predicted 618
6 SASI_Mm02_00416005 predicted 395
7 SASI_Mm02_00416006 predicted 633
8 SASI_Mm02_00416007 predicted 419
9 SASI_Mm02_00416008 predicted 295
10 SASI_Mm02_00416009 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00422642 predicted 468
2 SASI_Mm02_00422643 predicted 443
3 SASI_Mm02_00422644 predicted 399
4 SASI_Mm02_00422645 predicted 422
5 SASI_Mm02_00422646 predicted 399
6 SASI_Mm02_00422647 predicted 372
7 SASI_Mm02_00422648 predicted 390
8 SASI_Mm02_00422649 predicted 500
9 SASI_Mm02_00422650 predicted 299
10 SASI_Mm02_00422651 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238907 predicted 508
2 SASI_Mm01_00238908 predicted 511
3 SASI_Mm01_00238909 predicted 475
4 SASI_Mm01_00238910 predicted 450
5 SASI_Mm01_00238911 predicted 405
6 SASI_Mm01_00238912 predicted 430
7 SASI_Mm01_00238913 predicted 308
8 SASI_Mm01_00238914 predicted 403
9 SASI_Mm01_00238915 predicted 426
10 SASI_Mm01_00238916 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182756
SPDYA MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182756.3-744s21c1
Sequence:CCGGCGATGTTGTGAGGAGGTTATGCTCGAGCATAACCTCCTCACAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182756.3-715s21c1
Sequence:CCGGGAATTGACTATAGGGCTATTGCTCGAGCAATAGCCCTATAGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-804s1c1
Sequence:CCGGGCTGTCAGAAACTACAACAGACTCGAGTCTGTTGTAGTTTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-774s1c1
Sequence:CCGGCAAAGAGAACGTTCTGTTCATCTCGAGATGAACAGAACGTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-1104s1c1
Sequence:CCGGGAGTGGTTTACAGGAAGTGAACTCGAGTTCACTTCCTGTAAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-597s1c1
Sequence:CCGGGAAGAAGAAACCAAGTACGAACTCGAGTTCGTACTTGGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182756
SPDYA MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182756.3-744s21c1
Sequence:CCGGCGATGTTGTGAGGAGGTTATGCTCGAGCATAACCTCCTCACAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182756.3-715s21c1
Sequence:CCGGGAATTGACTATAGGGCTATTGCTCGAGCAATAGCCCTATAGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-804s1c1
Sequence:CCGGGCTGTCAGAAACTACAACAGACTCGAGTCTGTTGTAGTTTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-774s1c1
Sequence:CCGGCAAAGAGAACGTTCTGTTCATCTCGAGATGAACAGAACGTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-1104s1c1
Sequence:CCGGGAGTGGTTTACAGGAAGTGAACTCGAGTTCACTTCCTGTAAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-597s1c1
Sequence:CCGGGAAGAAGAAACCAAGTACGAACTCGAGTTCGTACTTGGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182756
SPDYA MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182756.3-744s21c1
Sequence:CCGGCGATGTTGTGAGGAGGTTATGCTCGAGCATAACCTCCTCACAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182756.3-715s21c1
Sequence:CCGGGAATTGACTATAGGGCTATTGCTCGAGCAATAGCCCTATAGTCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-804s1c1
Sequence:CCGGGCTGTCAGAAACTACAACAGACTCGAGTCTGTTGTAGTTTCTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-774s1c1
Sequence:CCGGCAAAGAGAACGTTCTGTTCATCTCGAGATGAACAGAACGTTCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-1104s1c1
Sequence:CCGGGAGTGGTTTACAGGAAGTGAACTCGAGTTCACTTCCTGTAAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182756.1-597s1c1
Sequence:CCGGGAAGAAGAAACCAAGTACGAACTCGAGTTCGTACTTGGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001480221
SPDYA MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-605s21c1
Sequence:CCGGGAATTGACTATAGGGCTATTGCTCGAGCAATAGCCCTATAGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-193s21c1
Sequence:CCGGATTAGTCTGAAACGTCCTATTCTCGAGAATAGGACGTTTCAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-471s21c1
Sequence:CCGGTGCTCTGTATCTGGCTAATACCTCGAGGTATTAGCCAGATACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-275s21c1
Sequence:CCGGGAGGGCCTTGTCTAATCATACCTCGAGGTATGATTAGACAAGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-444s21c1
Sequence:CCGGTGAGCATACCAGGATAAATTTCTCGAGAAATTTATCCTGGTATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001480221
SPDYA MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-605s21c1
Sequence:CCGGGAATTGACTATAGGGCTATTGCTCGAGCAATAGCCCTATAGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-193s21c1
Sequence:CCGGATTAGTCTGAAACGTCCTATTCTCGAGAATAGGACGTTTCAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-471s21c1
Sequence:CCGGTGCTCTGTATCTGGCTAATACCTCGAGGTATTAGCCAGATACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-275s21c1
Sequence:CCGGGAGGGCCTTGTCTAATCATACCTCGAGGTATGATTAGACAAGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-444s21c1
Sequence:CCGGTGAGCATACCAGGATAAATTTCTCGAGAAATTTATCCTGGTATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001480221
SPDYA MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-605s21c1
Sequence:CCGGGAATTGACTATAGGGCTATTGCTCGAGCAATAGCCCTATAGTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-193s21c1
Sequence:CCGGATTAGTCTGAAACGTCCTATTCTCGAGAATAGGACGTTTCAGACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-471s21c1
Sequence:CCGGTGCTCTGTATCTGGCTAATACCTCGAGGTATTAGCCAGATACAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-275s21c1
Sequence:CCGGGAGGGCCTTGTCTAATCATACCTCGAGGTATGATTAGACAAGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001480221.1-444s21c1
Sequence:CCGGTGAGCATACCAGGATAAATTTCTCGAGAAATTTATCCTGGTATGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks