EMAIL THIS PAGE TO A FRIEND

SPDYC

speedy/RINGO cell cycle regulator family member C

Synonyms: RINGOC Ringo2
UniProtKB ID: Q5MJ68, B2RP32, B7ZMH7
Gene ID:
cow(513874) speedy/RINGO cell cycle regulator family member C
sheep(101121472) speedy homolog C (Xenopus laevis)
domestic cat(101096670) speedy homolog C (Xenopus laevis)
dog(476026) speedy homolog C (Xenopus laevis)
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008778 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008778 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187151 predicted 338
2 SASI_Hs01_00187153 predicted 333
3 SASI_Hs01_00187154 predicted 506
4 SASI_Hs01_00187155 predicted 475
5 SASI_Hs01_00187156 predicted 263
6 SASI_Hs01_00187157 predicted 453
7 SASI_Hs01_00187158 predicted 505
8 SASI_Hs02_00305567 predicted 330
9 SASI_Hs01_00187160 predicted 297
10 SASI_Hs02_00305568 predicted 460
11 SASI_Hs01_00187152 predicted 297
12 SASI_Hs01_00187159 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008778
SPDYC MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-236s1c1
Sequence:CCGGCCTGCTTCCAGATTTCAGATACTCGAGTATCTGAAATCTGGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-243s1c1
Sequence:CCGGCCAGATTTCAGATAAGTATCTCTCGAGAGATACTTATCTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-246s1c1
Sequence:CCGGGATTTCAGATAAGTATCTCCTCTCGAGAGGAGATACTTATCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-717s21c1
Sequence:CCGGTCTGACCTCTGAATGTCATCGCTCGAGCGATGACATTCAGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-417s21c1
Sequence:CCGGAGATTGGTGTTTACGAGTGGGCTCGAGCCCACTCGTAAACACCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-445s21c1
Sequence:CCGGCTGCACCAGAGGGATAAGCTTCTCGAGAAGCTTATCCCTCTGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-672s1c1
Sequence:CCGGCTGCAGCAGCCACTTGCTTAACTCGAGTTAAGCAAGTGGCTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-299s1c1
Sequence:CCGGACCTGAAGCTCAGCGAGTATACTCGAGTATACTCGCTGAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008778
SPDYC MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-236s1c1
Sequence:CCGGCCTGCTTCCAGATTTCAGATACTCGAGTATCTGAAATCTGGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-243s1c1
Sequence:CCGGCCAGATTTCAGATAAGTATCTCTCGAGAGATACTTATCTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-246s1c1
Sequence:CCGGGATTTCAGATAAGTATCTCCTCTCGAGAGGAGATACTTATCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-717s21c1
Sequence:CCGGTCTGACCTCTGAATGTCATCGCTCGAGCGATGACATTCAGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-417s21c1
Sequence:CCGGAGATTGGTGTTTACGAGTGGGCTCGAGCCCACTCGTAAACACCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-445s21c1
Sequence:CCGGCTGCACCAGAGGGATAAGCTTCTCGAGAAGCTTATCCCTCTGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-672s1c1
Sequence:CCGGCTGCAGCAGCCACTTGCTTAACTCGAGTTAAGCAAGTGGCTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-299s1c1
Sequence:CCGGACCTGAAGCTCAGCGAGTATACTCGAGTATACTCGCTGAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008778
SPDYC MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-236s1c1
Sequence:CCGGCCTGCTTCCAGATTTCAGATACTCGAGTATCTGAAATCTGGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-243s1c1
Sequence:CCGGCCAGATTTCAGATAAGTATCTCTCGAGAGATACTTATCTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-246s1c1
Sequence:CCGGGATTTCAGATAAGTATCTCCTCTCGAGAGGAGATACTTATCTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-717s21c1
Sequence:CCGGTCTGACCTCTGAATGTCATCGCTCGAGCGATGACATTCAGAGGTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-417s21c1
Sequence:CCGGAGATTGGTGTTTACGAGTGGGCTCGAGCCCACTCGTAAACACCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008778.1-445s21c1
Sequence:CCGGCTGCACCAGAGGGATAAGCTTCTCGAGAAGCTTATCCCTCTGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-672s1c1
Sequence:CCGGCTGCAGCAGCCACTTGCTTAACTCGAGTTAAGCAAGTGGCTGCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008778.1-299s1c1
Sequence:CCGGACCTGAAGCTCAGCGAGTATACTCGAGTATACTCGCTGAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks