EMAIL THIS PAGE TO A FRIEND

SPDYE1

speedy/RINGO cell cycle regulator family member E1

Synonyms: Ringo1 SPDYE WBSCR19
Species: Human SPDYE1(285955)
UniProtKB ID: Q8NFV5, Q9NTH5
Gene ID:
Human(285955) Summary: This gene is located at chromosome 7p13 which is close to the Williams Beuren syndrome chromosome region 7q11.23. [provided by RefSeq, Jul 2008]
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175064 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175064
SPDYE1 MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175064.2-666s21c1
Sequence:CCGGTGAGGGTGTCGGACAAGTATCCTCGAGGATACTTGTCCGACACCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175064.2-1540s21c1
Sequence:CCGGGGAGCATTTGAAGGCACAATGCTCGAGCATTGTGCCTTCAAATGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175064.2-926s21c1
Sequence:CCGGCACATACCCTTGGTCCGTAAGCTCGAGCTTACGGACCAAGGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-370s1c1
Sequence:CCGGCCACAAGGACTTCAACAGTCACTCGAGTGACTGTTGAAGTCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-748s1c1
Sequence:CCGGCCTTCATTTCTTCCTGGCTCTCTCGAGAGAGCCAGGAAGAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175064.2-1309s1c1
Sequence:CCGGCCATTCTTGATGGAGCTGAATCTCGAGATTCAGCTCCATCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-320s1c1
Sequence:CCGGCTCAAGATGAAGCTGAAGCAACTCGAGTTGCTTCAGCTTCATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175064.2-2224s1c1
Sequence:CCGGGTTTCTATAAAGCTGTGTGATCTCGAGATCACACAGCTTTATAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-689s1c1
Sequence:CCGGCTTGCTATGGTCATAGCGTATCTCGAGATACGCTATGACCATAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175064
SPDYE1 MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175064.2-666s21c1
Sequence:CCGGTGAGGGTGTCGGACAAGTATCCTCGAGGATACTTGTCCGACACCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175064.2-1540s21c1
Sequence:CCGGGGAGCATTTGAAGGCACAATGCTCGAGCATTGTGCCTTCAAATGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175064.2-926s21c1
Sequence:CCGGCACATACCCTTGGTCCGTAAGCTCGAGCTTACGGACCAAGGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-370s1c1
Sequence:CCGGCCACAAGGACTTCAACAGTCACTCGAGTGACTGTTGAAGTCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-748s1c1
Sequence:CCGGCCTTCATTTCTTCCTGGCTCTCTCGAGAGAGCCAGGAAGAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175064.2-1309s1c1
Sequence:CCGGCCATTCTTGATGGAGCTGAATCTCGAGATTCAGCTCCATCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-320s1c1
Sequence:CCGGCTCAAGATGAAGCTGAAGCAACTCGAGTTGCTTCAGCTTCATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175064.2-2224s1c1
Sequence:CCGGGTTTCTATAAAGCTGTGTGATCTCGAGATCACACAGCTTTATAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-689s1c1
Sequence:CCGGCTTGCTATGGTCATAGCGTATCTCGAGATACGCTATGACCATAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175064
SPDYE1 MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175064.2-666s21c1
Sequence:CCGGTGAGGGTGTCGGACAAGTATCCTCGAGGATACTTGTCCGACACCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175064.2-1540s21c1
Sequence:CCGGGGAGCATTTGAAGGCACAATGCTCGAGCATTGTGCCTTCAAATGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175064.2-926s21c1
Sequence:CCGGCACATACCCTTGGTCCGTAAGCTCGAGCTTACGGACCAAGGGTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-370s1c1
Sequence:CCGGCCACAAGGACTTCAACAGTCACTCGAGTGACTGTTGAAGTCCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-748s1c1
Sequence:CCGGCCTTCATTTCTTCCTGGCTCTCTCGAGAGAGCCAGGAAGAAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163830    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175064.2-1309s1c1
Sequence:CCGGCCATTCTTGATGGAGCTGAATCTCGAGATTCAGCTCCATCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-320s1c1
Sequence:CCGGCTCAAGATGAAGCTGAAGCAACTCGAGTTGCTTCAGCTTCATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159863    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175064.2-2224s1c1
Sequence:CCGGGTTTCTATAAAGCTGTGTGATCTCGAGATCACACAGCTTTATAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175064.2-689s1c1
Sequence:CCGGCTTGCTATGGTCATAGCGTATCTCGAGATACGCTATGACCATAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks