EMAIL THIS PAGE TO A FRIEND

SPDYE2

speedy/RINGO cell cycle regulator family member E2

Synonyms: SPDYB2-L1
Species: Human SPDYE2(441273)
UniProtKB ID: Q495Y8, B4DY11
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044799 Anti-SPDYE2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031618 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031618 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031618 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230271 MISSION® esiRNA esiRNA targeting human SPDYE2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031618 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043078 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031618
SPDYE2 MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-654s1c1
Sequence:CCGGCCAGTTATACCGTTCCACGAACTCGAGTTCGTGGAACGGTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-247s1c1
Sequence:CCGGCTCAAGATGAAGCTGAAGCGACTCGAGTCGCTTCAGCTTCATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-435s1c1
Sequence:CCGGGCAATACCAACGCATTCATTTCTCGAGAAATGAATGCGTTGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-318s1c1
Sequence:CCGGGCTTGAGGATCCTGTCATTAACTCGAGTTAATGACAGGATCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-726s1c1
Sequence:CCGGGTTCCAGTTATACCGTTCCATCTCGAGATGGAACGGTATAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-522s1c1
Sequence:CCGGCCACTTCCTGTATAGGAAGAACTCGAGTTCTTCCTATACAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-388s1c1
Sequence:CCGGCTGGCTATGGTCATAGCGTATCTCGAGATACGCTATGACCATAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031618
SPDYE2 MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-654s1c1
Sequence:CCGGCCAGTTATACCGTTCCACGAACTCGAGTTCGTGGAACGGTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-247s1c1
Sequence:CCGGCTCAAGATGAAGCTGAAGCGACTCGAGTCGCTTCAGCTTCATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-435s1c1
Sequence:CCGGGCAATACCAACGCATTCATTTCTCGAGAAATGAATGCGTTGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-318s1c1
Sequence:CCGGGCTTGAGGATCCTGTCATTAACTCGAGTTAATGACAGGATCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-726s1c1
Sequence:CCGGGTTCCAGTTATACCGTTCCATCTCGAGATGGAACGGTATAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-522s1c1
Sequence:CCGGCCACTTCCTGTATAGGAAGAACTCGAGTTCTTCCTATACAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-388s1c1
Sequence:CCGGCTGGCTATGGTCATAGCGTATCTCGAGATACGCTATGACCATAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031618
SPDYE2 MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-654s1c1
Sequence:CCGGCCAGTTATACCGTTCCACGAACTCGAGTTCGTGGAACGGTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-247s1c1
Sequence:CCGGCTCAAGATGAAGCTGAAGCGACTCGAGTCGCTTCAGCTTCATCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-435s1c1
Sequence:CCGGGCAATACCAACGCATTCATTTCTCGAGAAATGAATGCGTTGGTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-318s1c1
Sequence:CCGGGCTTGAGGATCCTGTCATTAACTCGAGTTAATGACAGGATCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-726s1c1
Sequence:CCGGGTTCCAGTTATACCGTTCCATCTCGAGATGGAACGGTATAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-522s1c1
Sequence:CCGGCCACTTCCTGTATAGGAAGAACTCGAGTTCTTCCTATACAGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031618.1-388s1c1
Sequence:CCGGCTGGCTATGGTCATAGCGTATCTCGAGATACGCTATGACCATAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks