EMAIL THIS PAGE TO A FRIEND

SPDYE3

speedy/RINGO cell cycle regulator family member E3

Species: Human SPDYE3(441272)
UniProtKB ID: A6NKU9, Q495Y9, Q6PHC4
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301072 ANTI-SPDYE3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004351 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183460 predicted 536
2 SASI_Hs02_00304570 predicted 544
3 SASI_Hs02_00304571 predicted 519
4 SASI_Hs02_00304572 predicted 516
5 SASI_Hs01_00183461 predicted 558
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004351
SPDYE3 MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1917s1c1
Sequence:CCGGGAACTTTATTCCAGTGCTAATCTCGAGATTAGCACTGGAATAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1583s1c1
Sequence:CCGGCTTCTACTTCCTGTACGGGAACTCGAGTTCCCGTACAGGAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1428s1c1
Sequence:CCGGCTGAGGGTGTCAGACAAGTATCTCGAGATACTTGTCTGACACCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1380s1c1
Sequence:CCGGCTGCTTGAGGATCCTGTCATTCTCGAGAATGACAGGATCCTCAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1438s1c1
Sequence:CCGGCAGACAAGTATCTCCTGGCTACTCGAGTAGCCAGGAGATACTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004351.1-1679s1c1
Sequence:CCGGGAACTGCTCTCAGATAGCCTTCTCGAGAAGGCTATCTGAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004351
SPDYE3 MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1917s1c1
Sequence:CCGGGAACTTTATTCCAGTGCTAATCTCGAGATTAGCACTGGAATAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1583s1c1
Sequence:CCGGCTTCTACTTCCTGTACGGGAACTCGAGTTCCCGTACAGGAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1428s1c1
Sequence:CCGGCTGAGGGTGTCAGACAAGTATCTCGAGATACTTGTCTGACACCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1380s1c1
Sequence:CCGGCTGCTTGAGGATCCTGTCATTCTCGAGAATGACAGGATCCTCAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1438s1c1
Sequence:CCGGCAGACAAGTATCTCCTGGCTACTCGAGTAGCCAGGAGATACTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004351.1-1679s1c1
Sequence:CCGGGAACTGCTCTCAGATAGCCTTCTCGAGAAGGCTATCTGAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004351
SPDYE3 MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1917s1c1
Sequence:CCGGGAACTTTATTCCAGTGCTAATCTCGAGATTAGCACTGGAATAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173057    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1583s1c1
Sequence:CCGGCTTCTACTTCCTGTACGGGAACTCGAGTTCCCGTACAGGAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1428s1c1
Sequence:CCGGCTGAGGGTGTCAGACAAGTATCTCGAGATACTTGTCTGACACCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1380s1c1
Sequence:CCGGCTGCTTGAGGATCCTGTCATTCTCGAGAATGACAGGATCCTCAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173032    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004351.1-1438s1c1
Sequence:CCGGCAGACAAGTATCTCCTGGCTACTCGAGTAGCCAGGAGATACTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172603    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004351.1-1679s1c1
Sequence:CCGGGAACTGCTCTCAGATAGCCTTCTCGAGAAGGCTATCTGAGAGCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks