EMAIL THIS PAGE TO A FRIEND

SPDYE4

speedy/RINGO cell cycle regulator family member E4

UniProtKB ID: A6NLX3, B2RUZ6
Gene ID:
Rat(498146) speedy/RINGO cell cycle regulator family member E4
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001128076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128076 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116481 MISSION® esiRNA esiRNA human AC009451.21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128076 Rosetta Predictions human pricing
XM_371014 Rosetta Predictions human pricing
NM_001034153 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330486 predicted 305
2 SASI_Hs02_00330487 predicted 467
3 SASI_Hs02_00330488 predicted 338
4 SASI_Hs02_00330489 predicted 611
5 SASI_Hs02_00330490 predicted 310
6 SASI_Hs02_00330491 predicted 620
7 SASI_Hs02_00330492 predicted 305
8 SASI_Hs02_00330493 predicted 614
9 SASI_Hs02_00330494 predicted 214
10 SASI_Hs02_00330495 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300602 predicted 265
2 SASI_Hs01_00300603 predicted 423
3 SASI_Hs01_00300604 predicted 282
4 SASI_Hs01_00300605 predicted 259
5 SASI_Hs01_00300606 predicted 260
6 SASI_Hs01_00300607 predicted 409
7 SASI_Hs01_00300608 predicted 417
8 SASI_Hs01_00300609 predicted 612
9 SASI_Hs01_00300610 predicted 673
10 SASI_Hs01_00300611 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082145 predicted 597
2 SASI_Rn01_00082146 predicted 1240
3 SASI_Rn01_00082147 predicted 1160
4 SASI_Rn01_00082148 predicted 1096
5 SASI_Rn01_00082149 predicted 766
6 SASI_Rn01_00082150 predicted 892
7 SASI_Rn01_00082151 predicted 1245
8 SASI_Rn01_00082152 predicted 1238
9 SASI_Rn01_00082153 predicted 565
10 SASI_Rn02_00204012 predicted 767
11 SASI_Rn01_00082154 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128076
SPDYE4 MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-339s21c1
Sequence:CCGGGAGCGAATGGTCAGACGAATCCTCGAGGATTCGTCTGACCATTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-699s21c1
Sequence:CCGGCCCGAAACAAGACATCTTCTCCTCGAGGAGAAGATGTCTTGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-313s21c1
Sequence:CCGGCCTCAATCCCTTGGCCTGAAACTCGAGTTTCAGGCCAAGGGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-620s21c1
Sequence:CCGGTCTTCTCGTGGCAATACCAACCTCGAGGTTGGTATTGCCACGAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-744s21c1
Sequence:CCGGCCAGCGACCCTTGTTCCATAACTCGAGTTATGGAACAAGGGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128076
SPDYE4 MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-339s21c1
Sequence:CCGGGAGCGAATGGTCAGACGAATCCTCGAGGATTCGTCTGACCATTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-699s21c1
Sequence:CCGGCCCGAAACAAGACATCTTCTCCTCGAGGAGAAGATGTCTTGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-313s21c1
Sequence:CCGGCCTCAATCCCTTGGCCTGAAACTCGAGTTTCAGGCCAAGGGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-620s21c1
Sequence:CCGGTCTTCTCGTGGCAATACCAACCTCGAGGTTGGTATTGCCACGAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-744s21c1
Sequence:CCGGCCAGCGACCCTTGTTCCATAACTCGAGTTATGGAACAAGGGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128076
SPDYE4 MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-339s21c1
Sequence:CCGGGAGCGAATGGTCAGACGAATCCTCGAGGATTCGTCTGACCATTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-699s21c1
Sequence:CCGGCCCGAAACAAGACATCTTCTCCTCGAGGAGAAGATGTCTTGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-313s21c1
Sequence:CCGGCCTCAATCCCTTGGCCTGAAACTCGAGTTTCAGGCCAAGGGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-620s21c1
Sequence:CCGGTCTTCTCGTGGCAATACCAACCTCGAGGTTGGTATTGCCACGAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128076.1-744s21c1
Sequence:CCGGCCAGCGACCCTTGTTCCATAACTCGAGTTATGGAACAAGGGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks