EMAIL THIS PAGE TO A FRIEND

SPDYE5

speedy/RINGO cell cycle regulator family member E5

Species: Human SPDYE5(442590)
UniProtKB ID: A6NIY4
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301836 ANTI-SPDYE5 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721765 Rosetta Predictions human pricing
XM_933654 Rosetta Predictions human pricing
XM_933656 Rosetta Predictions human pricing
XM_933669 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444886 predicted 413
2 SASI_Hs02_00444887 predicted 810
3 SASI_Hs02_00444888 predicted 933
4 SASI_Hs02_00444889 predicted 951
5 SASI_Hs02_00444890 predicted 953
6 SASI_Hs02_00444891 predicted 800
7 SASI_Hs02_00444892 predicted 832
8 SASI_Hs02_00444893 predicted 809
9 SASI_Hs02_00444894 predicted 958
10 SASI_Hs02_00444895 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248994 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282709 predicted 726
2 SASI_Hs01_00282710 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286686 predicted 1423
2 SASI_Hs01_00286687 predicted 1413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099435
SPDYE5 MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000256760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-687s21c1
Sequence:CCGGATCTCCTGGCTATGGTCATAGCTCGAGCTATGACCATAGCCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-1005s21c1
Sequence:CCGGAGATAGTCCTGTTCCAGAAACCTCGAGGTTTCTGGAACAGGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-623s21c1
Sequence:CCGGCTTGAGGATCCTGTCATTAAACTCGAGTTTAATGACAGGATCCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099435.2-2251s21c1
Sequence:CCGGGCTGTGTGATGGGTGTTATAACTCGAGTTATAACACCCATCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099435
SPDYE5 MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000256760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-687s21c1
Sequence:CCGGATCTCCTGGCTATGGTCATAGCTCGAGCTATGACCATAGCCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-1005s21c1
Sequence:CCGGAGATAGTCCTGTTCCAGAAACCTCGAGGTTTCTGGAACAGGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-623s21c1
Sequence:CCGGCTTGAGGATCCTGTCATTAAACTCGAGTTTAATGACAGGATCCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099435.2-2251s21c1
Sequence:CCGGGCTGTGTGATGGGTGTTATAACTCGAGTTATAACACCCATCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099435
SPDYE5 MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000256760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-687s21c1
Sequence:CCGGATCTCCTGGCTATGGTCATAGCTCGAGCTATGACCATAGCCAGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-1005s21c1
Sequence:CCGGAGATAGTCCTGTTCCAGAAACCTCGAGGTTTCTGGAACAGGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099435.2-623s21c1
Sequence:CCGGCTTGAGGATCCTGTCATTAAACTCGAGTTTAATGACAGGATCCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099435.2-2251s21c1
Sequence:CCGGGCTGTGTGATGGGTGTTATAACTCGAGTTATAACACCCATCACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks