EMAIL THIS PAGE TO A FRIEND

SPDYE7P

speedy/RINGO cell cycle regulator family member E7, pseudogene

Species: Human SPDYE7P(441251)
UniProtKB ID: Q495Y7
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034844 Rosetta Predictions human pricing
NR_003666 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051198 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380008 predicted 3592
2 SASI_Hs02_00380009 predicted 2571
3 SASI_Hs02_00380010 predicted 3682
4 SASI_Hs02_00380011 predicted 3633
5 SASI_Hs02_00380012 predicted 2478
6 SASI_Hs02_00380013 predicted 3591
7 SASI_Hs02_00380014 predicted 3648
8 SASI_Hs02_00380015 predicted 2581
9 SASI_Hs02_00380016 predicted 3585
10 SASI_Hs02_00380017 predicted 3638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034844
SPDYE7P MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E7, pseudogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-576s1c1
Sequence:CCGGGTTCCAGTTATGCCGTTGCATCTCGAGATGCAACGGCATAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034844.1-847s1c1
Sequence:CCGGCAGCAGGAACTTTATTCCAATCTCGAGATTGGAATAAAGTTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-441s1c1
Sequence:CCGGCCAATGCATTCATTTCTTCCTCTCGAGAGGAAGAAATGAATGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-318s1c1
Sequence:CCGGGCTTGAGGATCCTGTCATTAACTCGAGTTAATGACAGGATCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-651s1c1
Sequence:CCGGGTTCCAGTTCTTCTGTTCCATCTCGAGATGGAACAGAAGAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-625s1c1
Sequence:CCGGCAGATAGTCCTGTTCCAGAAACTCGAGTTTCTGGAACAGGACTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-519s1c1
Sequence:CCGGCTTCTACTTCCTGTATGGGAACTCGAGTTCCCATACAGGAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-447s1c1
Sequence:CCGGCATTCATTTCTTCCTGGCTCTCTCGAGAGAGCCAGGAAGAAATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034844.1-886s1c1
Sequence:CCGGGAAGAAGGAGAGGAACCATTTCTCGAGAAATGGTTCCTCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034844
SPDYE7P MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E7, pseudogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-576s1c1
Sequence:CCGGGTTCCAGTTATGCCGTTGCATCTCGAGATGCAACGGCATAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034844.1-847s1c1
Sequence:CCGGCAGCAGGAACTTTATTCCAATCTCGAGATTGGAATAAAGTTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-441s1c1
Sequence:CCGGCCAATGCATTCATTTCTTCCTCTCGAGAGGAAGAAATGAATGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-318s1c1
Sequence:CCGGGCTTGAGGATCCTGTCATTAACTCGAGTTAATGACAGGATCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-651s1c1
Sequence:CCGGGTTCCAGTTCTTCTGTTCCATCTCGAGATGGAACAGAAGAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-625s1c1
Sequence:CCGGCAGATAGTCCTGTTCCAGAAACTCGAGTTTCTGGAACAGGACTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-519s1c1
Sequence:CCGGCTTCTACTTCCTGTATGGGAACTCGAGTTCCCATACAGGAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-447s1c1
Sequence:CCGGCATTCATTTCTTCCTGGCTCTCTCGAGAGAGCCAGGAAGAAATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034844.1-886s1c1
Sequence:CCGGGAAGAAGGAGAGGAACCATTTCTCGAGAAATGGTTCCTCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034844
SPDYE7P MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E7, pseudogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-576s1c1
Sequence:CCGGGTTCCAGTTATGCCGTTGCATCTCGAGATGCAACGGCATAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034844.1-847s1c1
Sequence:CCGGCAGCAGGAACTTTATTCCAATCTCGAGATTGGAATAAAGTTCCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-441s1c1
Sequence:CCGGCCAATGCATTCATTTCTTCCTCTCGAGAGGAAGAAATGAATGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-318s1c1
Sequence:CCGGGCTTGAGGATCCTGTCATTAACTCGAGTTAATGACAGGATCCTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-651s1c1
Sequence:CCGGGTTCCAGTTCTTCTGTTCCATCTCGAGATGGAACAGAAGAACTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034844.1-625s1c1
Sequence:CCGGCAGATAGTCCTGTTCCAGAAACTCGAGTTTCTGGAACAGGACTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-519s1c1
Sequence:CCGGCTTCTACTTCCTGTATGGGAACTCGAGTTCCCATACAGGAAGTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034844.1-447s1c1
Sequence:CCGGCATTCATTTCTTCCTGGCTCTCTCGAGAGAGCCAGGAAGAAATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034844.1-886s1c1
Sequence:CCGGGAAGAAGGAGAGGAACCATTTCTCGAGAAATGGTTCCTCTCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks