EMAIL THIS PAGE TO A FRIEND

SPDYE8P

speedy/RINGO cell cycle regulator family member E8, pseudogene

Species: Human SPDYE8P(389517)
Gene ID:
7 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001032389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001032389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001032389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003664 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380003 predicted 586
2 SASI_Hs02_00380004 predicted 24
3 SASI_Hs02_00380005 predicted 1877
4 SASI_Hs02_00380006 predicted 527
5 SASI_Hs02_00380007 predicted 79
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001032389
SPDYE8P MISSION shRNA Bacterial Glycerol Stock
speedy/RINGO cell cycle regulator family member E8, pseudogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1210s1c1
Sequence:CCGGCAGGAAGAACTGCTCTCAGATCTCGAGATCTGAGAGCAGTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1228s1c1
Sequence:CCGGGATAGCCTTGTTCCGGAAGTACTCGAGTACTTCCGGAACAAGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1303s1c1
Sequence:CCGGGTTGGAAGAGATCCAGGCTTACTCGAGTAAGCCTGGATCTCTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-761s1c1
Sequence:CCGGGAATGTTTGGATGAATCTGATCTCGAGATCAGATTCATCCAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032389.1-1534s1c1
Sequence:CCGGCCATTCTTGACAGAGCTGAATCTCGAGATTCAGCTCTGTCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-770s1c1
Sequence:CCGGGATGAATCTGATGATGAGCCACTCGAGTGGCTCATCATCAGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1052s1c1
Sequence:CCGGCATTTCTTCCTGGCTCTCTATCTCGAGATAGAGAGCCAGGAAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1159s1c1
Sequence:CCGGCTTGCTCAGTGAGCTTTGGTTCTCGAGAACCAAAGCTCACTGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1146s1c1
Sequence:CCGGGCTCTCATATACCCTTGCTCACTCGAGTGAGCAAGGGTATATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001032389
SPDYE8P MISSION shRNA shRNA Plasmid DNA
speedy/RINGO cell cycle regulator family member E8, pseudogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1210s1c1
Sequence:CCGGCAGGAAGAACTGCTCTCAGATCTCGAGATCTGAGAGCAGTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1228s1c1
Sequence:CCGGGATAGCCTTGTTCCGGAAGTACTCGAGTACTTCCGGAACAAGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1303s1c1
Sequence:CCGGGTTGGAAGAGATCCAGGCTTACTCGAGTAAGCCTGGATCTCTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-761s1c1
Sequence:CCGGGAATGTTTGGATGAATCTGATCTCGAGATCAGATTCATCCAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032389.1-1534s1c1
Sequence:CCGGCCATTCTTGACAGAGCTGAATCTCGAGATTCAGCTCTGTCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-770s1c1
Sequence:CCGGGATGAATCTGATGATGAGCCACTCGAGTGGCTCATCATCAGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1052s1c1
Sequence:CCGGCATTTCTTCCTGGCTCTCTATCTCGAGATAGAGAGCCAGGAAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1159s1c1
Sequence:CCGGCTTGCTCAGTGAGCTTTGGTTCTCGAGAACCAAAGCTCACTGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1146s1c1
Sequence:CCGGGCTCTCATATACCCTTGCTCACTCGAGTGAGCAAGGGTATATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001032389
SPDYE8P MISSION shRNA Lentiviral Transduction Particles
speedy/RINGO cell cycle regulator family member E8, pseudogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1210s1c1
Sequence:CCGGCAGGAAGAACTGCTCTCAGATCTCGAGATCTGAGAGCAGTTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1228s1c1
Sequence:CCGGGATAGCCTTGTTCCGGAAGTACTCGAGTACTTCCGGAACAAGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165641    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1303s1c1
Sequence:CCGGGTTGGAAGAGATCCAGGCTTACTCGAGTAAGCCTGGATCTCTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-761s1c1
Sequence:CCGGGAATGTTTGGATGAATCTGATCTCGAGATCAGATTCATCCAAACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162810    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001032389.1-1534s1c1
Sequence:CCGGCCATTCTTGACAGAGCTGAATCTCGAGATTCAGCTCTGTCAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-770s1c1
Sequence:CCGGGATGAATCTGATGATGAGCCACTCGAGTGGCTCATCATCAGATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1052s1c1
Sequence:CCGGCATTTCTTCCTGGCTCTCTATCTCGAGATAGAGAGCCAGGAAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1159s1c1
Sequence:CCGGCTTGCTCAGTGAGCTTTGGTTCTCGAGAACCAAAGCTCACTGAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165537    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001032389.1-1146s1c1
Sequence:CCGGGCTCTCATATACCCTTGCTCACTCGAGTGAGCAAGGGTATATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks