EMAIL THIS PAGE TO A FRIEND

SPECC1

sperm antigen with calponin homology and coiled-coil domains 1

Synonyms: CYTSB HCMOGT-1 HCMOGT1 NSP
Gene ID:
Human(92521) Summary: The protein encoded by this gene belongs to the cytospin-A family. It is localized in the nucleus, and highly expressed in testis and some cancer cell lines. A chromosomal translocation involving this gene and platelet-derived growth factor receptor, beta gene (PDGFRB) may be a cause of juvenile myelomonocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(432572) sperm antigen with calponin homology and coiled-coil domains 1
Rat(303208) sperm antigen with calponin homology and coiled-coil domains 1
Zebrafish(562343) sperm antigen with calponin homology and coiled-coil domains 1
domestic cat(101095694) sperm antigen with calponin homology and coiled-coil domains 1
dog(489524) sperm antigen with calponin homology and coiled-coil domains 1
chicken(417595) sperm antigen with calponin homology and coiled-coil domains 1
cow(506538) sperm antigen with calponin homology and coiled-coil domains 1
sheep(101107974) sperm antigen with calponin homology and coiled-coil domains 1
domestic guinea pig(100721138) sperm antigen with calponin homology and coiled-coil domains 1
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152904 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033553 Rosetta Predictions human pricing
NM_001033554 Rosetta Predictions human pricing
NM_001033555 Rosetta Predictions human pricing
NM_152904 Rosetta Predictions human pricing
NM_001039017 Rosetta Predictions rat pricing
NM_001029936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104928 predicted 2079
2 SASI_Hs01_00104929 predicted 1324
3 SASI_Hs01_00104930 predicted 1669
4 SASI_Hs02_00308044 predicted 674
5 SASI_Hs01_00104932 predicted 1850
6 SASI_Hs01_00104933 predicted 1614
7 SASI_Hs01_00104934 predicted 596
8 SASI_Hs01_00104935 predicted 1489
9 SASI_Hs01_00104936 predicted 2077
10 SASI_Hs02_00308045 predicted 656
11 SASI_Hs01_00104931 predicted 1790
12 SASI_Hs01_00104937 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036446 predicted 1893
2 SASI_Hs01_00036447 predicted 1132
3 SASI_Hs01_00036448 predicted 1482
4 SASI_Hs02_00308046 predicted 487
5 SASI_Hs01_00036450 predicted 1669
6 SASI_Hs01_00036451 predicted 1431
7 SASI_Hs01_00036452 predicted 407
8 SASI_Hs01_00036453 predicted 1299
9 SASI_Hs01_00036454 predicted 1893
10 SASI_Hs02_00308047 predicted 474
11 SASI_Hs01_00036449 predicted 1599
12 SASI_Hs01_00036455 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197650 predicted 1889
2 SASI_Hs01_00197651 predicted 1135
3 SASI_Hs01_00197652 predicted 1479
4 SASI_Hs02_00308048 predicted 483
5 SASI_Hs01_00197654 predicted 1669
6 SASI_Hs01_00197655 predicted 1422
7 SASI_Hs01_00197656 predicted 404
8 SASI_Hs01_00197657 predicted 1297
9 SASI_Hs01_00197658 predicted 1895
10 SASI_Hs02_00308049 predicted 476
11 SASI_Hs01_00197653 predicted 1604
12 SASI_Hs01_00197659 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058831 predicted 2071
2 SASI_Hs01_00058832 predicted 1316
3 SASI_Hs01_00058833 predicted 1673
4 SASI_Hs02_00366872 predicted 675
5 SASI_Hs01_00058835 predicted 1855
6 SASI_Hs01_00058836 predicted 1614
7 SASI_Hs01_00058837 predicted 595
8 SASI_Hs01_00058838 predicted 1491
9 SASI_Hs01_00058839 predicted 2083
10 SASI_Hs02_00366873 predicted 655
11 SASI_Hs01_00058834 predicted 1790
12 SASI_Hs01_00058840 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048778 predicted 1645
2 SASI_Rn02_00204747 predicted 1658
3 SASI_Rn01_00048779 predicted 363
4 SASI_Rn01_00048781 predicted 2063
5 SASI_Rn01_00048782 predicted 943
6 SASI_Rn01_00048783 predicted 1856
7 SASI_Rn01_00048784 predicted 1038
8 SASI_Rn01_00048785 predicted 2111
9 SASI_Rn01_00048786 predicted 835
10 SASI_Rn01_00048787 predicted 729
11 SASI_Rn01_00048780 predicted 1437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046823 predicted 1425
2 SASI_Mm01_00046824 predicted 2652
3 SASI_Mm01_00046825 predicted 1434
4 SASI_Mm01_00046826 predicted 1714
5 SASI_Mm01_00046827 predicted 1969
6 SASI_Mm02_00288065 predicted 238
7 SASI_Mm01_00046829 predicted 718
8 SASI_Mm01_00046830 predicted 1577
9 SASI_Mm01_00046832 predicted 2284
10 SASI_Mm02_00288066 predicted 613
11 SASI_Mm01_00046828 predicted 2297
12 SASI_Mm01_00046831 predicted 1678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152904
VALIDATED
SPECC1 MISSION shRNA Bacterial Glycerol Stock
sperm antigen with calponin homology and coiled-coil domains 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152904.1-932s1c1
Sequence:CCGGCCAGTGACATTGATGAGTATACTCGAGTATACTCATCAATGTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152904.1-677s1c1
Sequence:CCGGGCCCAAATGTCGATGGAACATCTCGAGATGTTCCATCGACATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152904.1-1557s1c1
Sequence:CCGGCCAAGGAGCTTTAGAAATGATCTCGAGATCATTTCTAAAGCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152904.1-1097s1c1
Sequence:CCGGCCTTTAAGAGTTCAAAGTGTTCTCGAGAACACTTTGAACTCTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1779s21c1
Sequence:CCGGGAGCTGCGAAGTTCAAGAAATCTCGAGATTTCTTGAACTTCGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152904.3-2449s21c1
Sequence:CCGGAGCCCAGCTCTTGCCATGATTCTCGAGAATCATGGCAAGAGCTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1242s21c1
Sequence:CCGGATTATCAGACCAGCAACAAATCTCGAGATTTGTTGCTGGTCTGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152904.3-2510s21c1
Sequence:CCGGGAGGAGAAATTGCCTCTTTATCTCGAGATAAAGAGGCAATTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-139s21c1
Sequence:CCGGTCCGGCATGAAGAGTTCTAAGCTCGAGCTTAGAACTCTTCATGCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1619s21c1
Sequence:CCGGTAGAACTGGAACGGCATAATACTCGAGTATTATGCCGTTCCAGTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-710s21c1
Sequence:CCGGGTGACACGGAACCTATGATAACTCGAGTTATCATAGGTTCCGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1704s21c1
Sequence:CCGGTGGATCTTTGAAGTCTCATTTCTCGAGAAATGAGACTTCAAAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152904
VALIDATED
SPECC1 MISSION shRNA shRNA Plasmid DNA
sperm antigen with calponin homology and coiled-coil domains 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152904.1-932s1c1
Sequence:CCGGCCAGTGACATTGATGAGTATACTCGAGTATACTCATCAATGTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152904.1-677s1c1
Sequence:CCGGGCCCAAATGTCGATGGAACATCTCGAGATGTTCCATCGACATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152904.1-1557s1c1
Sequence:CCGGCCAAGGAGCTTTAGAAATGATCTCGAGATCATTTCTAAAGCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152904.1-1097s1c1
Sequence:CCGGCCTTTAAGAGTTCAAAGTGTTCTCGAGAACACTTTGAACTCTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1779s21c1
Sequence:CCGGGAGCTGCGAAGTTCAAGAAATCTCGAGATTTCTTGAACTTCGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152904.3-2449s21c1
Sequence:CCGGAGCCCAGCTCTTGCCATGATTCTCGAGAATCATGGCAAGAGCTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1242s21c1
Sequence:CCGGATTATCAGACCAGCAACAAATCTCGAGATTTGTTGCTGGTCTGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152904.3-2510s21c1
Sequence:CCGGGAGGAGAAATTGCCTCTTTATCTCGAGATAAAGAGGCAATTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-139s21c1
Sequence:CCGGTCCGGCATGAAGAGTTCTAAGCTCGAGCTTAGAACTCTTCATGCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1619s21c1
Sequence:CCGGTAGAACTGGAACGGCATAATACTCGAGTATTATGCCGTTCCAGTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-710s21c1
Sequence:CCGGGTGACACGGAACCTATGATAACTCGAGTTATCATAGGTTCCGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1704s21c1
Sequence:CCGGTGGATCTTTGAAGTCTCATTTCTCGAGAAATGAGACTTCAAAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152904
VALIDATED
SPECC1 MISSION shRNA Lentiviral Transduction Particles
sperm antigen with calponin homology and coiled-coil domains 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152904.1-932s1c1
Sequence:CCGGCCAGTGACATTGATGAGTATACTCGAGTATACTCATCAATGTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180714    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152904.1-677s1c1
Sequence:CCGGGCCCAAATGTCGATGGAACATCTCGAGATGTTCCATCGACATTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152904.1-1557s1c1
Sequence:CCGGCCAAGGAGCTTTAGAAATGATCTCGAGATCATTTCTAAAGCTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183426    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152904.1-1097s1c1
Sequence:CCGGCCTTTAAGAGTTCAAAGTGTTCTCGAGAACACTTTGAACTCTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1779s21c1
Sequence:CCGGGAGCTGCGAAGTTCAAGAAATCTCGAGATTTCTTGAACTTCGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152904.3-2449s21c1
Sequence:CCGGAGCCCAGCTCTTGCCATGATTCTCGAGAATCATGGCAAGAGCTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1242s21c1
Sequence:CCGGATTATCAGACCAGCAACAAATCTCGAGATTTGTTGCTGGTCTGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152904.3-2510s21c1
Sequence:CCGGGAGGAGAAATTGCCTCTTTATCTCGAGATAAAGAGGCAATTTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-139s21c1
Sequence:CCGGTCCGGCATGAAGAGTTCTAAGCTCGAGCTTAGAACTCTTCATGCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1619s21c1
Sequence:CCGGTAGAACTGGAACGGCATAATACTCGAGTATTATGCCGTTCCAGTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-710s21c1
Sequence:CCGGGTGACACGGAACCTATGATAACTCGAGTTATCATAGGTTCCGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152904.3-1704s21c1
Sequence:CCGGTGGATCTTTGAAGTCTCATTTCTCGAGAAATGAGACTTCAAAGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029936
VALIDATED
SPECC1 MISSION shRNA Bacterial Glycerol Stock
sperm antigen with calponin homology and coiled-coil domains 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-1887s1c1
Sequence:CCGGGCGCCGTCAAGTTACACAATACTCGAGTATTGTGTAACTTGACGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-3995s1c1
Sequence:CCGGGCAGAAATAGAAACTGCGTTTCTCGAGAAACGCAGTTTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-2768s1c1
Sequence:CCGGGCGAACATTGATATCACCAATCTCGAGATTGGTGATATCAATGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-138s1c1
Sequence:CCGGCAGGGACTATTCCAACAACTACTCGAGTAGTTGTTGGAATAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-2768s21c1
Sequence:CCGGGCGAACATTGATATCACCAATCTCGAGATTGGTGATATCAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-1962s21c1
Sequence:CCGGCAGACCTAGAGCGGCAGTTAACTCGAGTTAACTGCCGCTCTAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-2289s21c1
Sequence:CCGGCAGTAAAGTCACTGATCAAATCTCGAGATTTGATCAGTGACTTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-3995s21c1
Sequence:CCGGGCAGAAATAGAAACTGCGTTTCTCGAGAAACGCAGTTTCTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-1887s21c1
Sequence:CCGGGCGCCGTCAAGTTACACAATACTCGAGTATTGTGTAACTTGACGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029936
VALIDATED
SPECC1 MISSION shRNA shRNA Plasmid DNA
sperm antigen with calponin homology and coiled-coil domains 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-1887s1c1
Sequence:CCGGGCGCCGTCAAGTTACACAATACTCGAGTATTGTGTAACTTGACGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-3995s1c1
Sequence:CCGGGCAGAAATAGAAACTGCGTTTCTCGAGAAACGCAGTTTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-2768s1c1
Sequence:CCGGGCGAACATTGATATCACCAATCTCGAGATTGGTGATATCAATGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-138s1c1
Sequence:CCGGCAGGGACTATTCCAACAACTACTCGAGTAGTTGTTGGAATAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-2768s21c1
Sequence:CCGGGCGAACATTGATATCACCAATCTCGAGATTGGTGATATCAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-1962s21c1
Sequence:CCGGCAGACCTAGAGCGGCAGTTAACTCGAGTTAACTGCCGCTCTAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-2289s21c1
Sequence:CCGGCAGTAAAGTCACTGATCAAATCTCGAGATTTGATCAGTGACTTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-3995s21c1
Sequence:CCGGGCAGAAATAGAAACTGCGTTTCTCGAGAAACGCAGTTTCTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-1887s21c1
Sequence:CCGGGCGCCGTCAAGTTACACAATACTCGAGTATTGTGTAACTTGACGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029936
VALIDATED
SPECC1 MISSION shRNA Lentiviral Transduction Particles
sperm antigen with calponin homology and coiled-coil domains 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-1887s1c1
Sequence:CCGGGCGCCGTCAAGTTACACAATACTCGAGTATTGTGTAACTTGACGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174616    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-3995s1c1
Sequence:CCGGGCAGAAATAGAAACTGCGTTTCTCGAGAAACGCAGTTTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-2768s1c1
Sequence:CCGGGCGAACATTGATATCACCAATCTCGAGATTGGTGATATCAATGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029936.1-138s1c1
Sequence:CCGGCAGGGACTATTCCAACAACTACTCGAGTAGTTGTTGGAATAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-2768s21c1
Sequence:CCGGGCGAACATTGATATCACCAATCTCGAGATTGGTGATATCAATGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-1962s21c1
Sequence:CCGGCAGACCTAGAGCGGCAGTTAACTCGAGTTAACTGCCGCTCTAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-2289s21c1
Sequence:CCGGCAGTAAAGTCACTGATCAAATCTCGAGATTTGATCAGTGACTTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-3995s21c1
Sequence:CCGGGCAGAAATAGAAACTGCGTTTCTCGAGAAACGCAGTTTCTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001029936.2-1887s21c1
Sequence:CCGGGCGCCGTCAAGTTACACAATACTCGAGTATTGTGTAACTTGACGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks