EMAIL THIS PAGE TO A FRIEND

SPECC1L

sperm antigen with calponin homology and coiled-coil domains 1-like

Synonyms: CYTSA OBLFC1
UniProtKB ID: Q69YQ0, B7Z758, F5H1H6, O15081
Gene ID:
Human(23384) Summary: This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
Mouse(74392) sperm antigen with calponin homology and coiled-coil domains 1-like
Rat(361828) sperm antigen with calponin homology and coiled-coil domains 1-like
domestic guinea pig(100718719) sperm antigen with calponin homology and coiled-coil domains 1-like
naked mole-rat(101717271) sperm antigen with calponin homology and coiled-coil domains 1-like
cow(519751) sperm antigen with calponin homology and coiled-coil domains 1-like
sheep(101113175) sperm antigen with calponin homology and coiled-coil domains 1-like
chicken(416950) sperm antigen with calponin homology and coiled-coil domains 1-like
domestic cat(101080485) sperm antigen with calponin homology and coiled-coil domains 1-like
dog(486397) sperm antigen with calponin homology and coiled-coil domains 1-like
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015330 Rosetta Predictions human pricing
NM_001039455 Rosetta Predictions rat pricing
NM_153406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069000 predicted 700
2 SASI_Hs01_00069001 predicted 1240
3 SASI_Hs02_00347629 predicted 933
4 SASI_Hs01_00069003 predicted 2346
5 SASI_Hs02_00347630 predicted 3338
6 SASI_Hs01_00069004 predicted 2120
7 SASI_Hs01_00069005 predicted 1584
8 SASI_Hs01_00069006 predicted 1609
9 SASI_Hs01_00069007 predicted 1848
10 SASI_Hs01_00069008 predicted 3411
11 SASI_Hs01_00068999 predicted 3248
12 SASI_Hs01_00069002 predicted 1910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204841 predicted 3389
2 SASI_Rn01_00100609 predicted 2085
3 SASI_Rn01_00100610 predicted 2924
4 SASI_Rn01_00100611 predicted 3200
5 SASI_Rn01_00100612 predicted 236
6 SASI_Rn01_00100613 predicted 3266
7 SASI_Rn01_00100614 predicted 2882
8 SASI_Rn01_00100616 predicted 2319
9 SASI_Rn01_00100617 predicted 3215
10 SASI_Rn02_00204842 predicted 1310
11 SASI_Rn01_00100608 predicted 2120
12 SASI_Rn01_00100615 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146905 predicted 2527
2 SASI_Mm01_00146906 predicted 1375
3 SASI_Mm02_00343191 predicted 3435
4 SASI_Mm01_00146907 predicted 1917
5 SASI_Mm01_00146908 predicted 1696
6 SASI_Mm01_00146909 predicted 1461
7 SASI_Mm01_00146910 predicted 2751
8 SASI_Mm01_00146911 predicted 2678
9 SASI_Mm01_00146914 predicted 834
10 SASI_Mm02_00343192 predicted 1146
11 SASI_Mm01_00146912 predicted 441
12 SASI_Mm01_00146913 predicted 2733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153406
VALIDATED
SPECC1L MISSION shRNA Bacterial Glycerol Stock
sperm antigen with calponin homology and coiled-coil domains 1-like
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1020s21c1
Sequence:CCGCTAGAGCAAAGGCTGGACAATTCTCGAGAATTGTCCAGCCTTTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153406.3-3601s21c1
Sequence:CCGGCCATTAGCTAGAACTCCTAAACTCGAGTTTAGGAGTTCTAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153406.3-3788s21c1
Sequence:CCGGTGGAGTGCAAACAGCATAAAGCTCGAGCTTTATGCTGTTTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-2491s21c1
Sequence:CCGGAGAAGAGATCGGTGATCTAAACTCGAGTTTAGATCACCGATCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1716s21c1
Sequence:CCGGTAGGTGTGCAGCAGCATTTAACTCGAGTTAAATGCTGCTGCACACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-3445s21c1
Sequence:CCGGGACGCTGGACATCAATGAAATCTCGAGATTTCATTGATGTCCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1619s21c1
Sequence:CCGGGTCATAGATGAAGACGTAAAGCTCGAGCTTTACGTCTTCATCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-1797s1c1
Sequence:CCGGGCTGAGTTGTATTCTATCCATCTCGAGATGGATAGAATACAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153406.2-379s1c1
Sequence:CCGGCCAGTTCTACTAGAGAAAGATCTCGAGATCTTTCTCTAGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-2138s1c1
Sequence:CCGGGCTGCATGACAACCTCATTATCTCGAGATAATGAGGTTGTCATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-3189s1c1
Sequence:CCGGCCAGCCCACATACCATATCAACTCGAGTTGATATGGTATGTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153406
VALIDATED
SPECC1L MISSION shRNA shRNA Plasmid DNA
sperm antigen with calponin homology and coiled-coil domains 1-like
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1020s21c1
Sequence:CCGCTAGAGCAAAGGCTGGACAATTCTCGAGAATTGTCCAGCCTTTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153406.3-3601s21c1
Sequence:CCGGCCATTAGCTAGAACTCCTAAACTCGAGTTTAGGAGTTCTAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153406.3-3788s21c1
Sequence:CCGGTGGAGTGCAAACAGCATAAAGCTCGAGCTTTATGCTGTTTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-2491s21c1
Sequence:CCGGAGAAGAGATCGGTGATCTAAACTCGAGTTTAGATCACCGATCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1716s21c1
Sequence:CCGGTAGGTGTGCAGCAGCATTTAACTCGAGTTAAATGCTGCTGCACACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-3445s21c1
Sequence:CCGGGACGCTGGACATCAATGAAATCTCGAGATTTCATTGATGTCCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1619s21c1
Sequence:CCGGGTCATAGATGAAGACGTAAAGCTCGAGCTTTACGTCTTCATCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-1797s1c1
Sequence:CCGGGCTGAGTTGTATTCTATCCATCTCGAGATGGATAGAATACAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153406.2-379s1c1
Sequence:CCGGCCAGTTCTACTAGAGAAAGATCTCGAGATCTTTCTCTAGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-2138s1c1
Sequence:CCGGGCTGCATGACAACCTCATTATCTCGAGATAATGAGGTTGTCATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-3189s1c1
Sequence:CCGGCCAGCCCACATACCATATCAACTCGAGTTGATATGGTATGTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153406
VALIDATED
SPECC1L MISSION shRNA Lentiviral Transduction Particles
sperm antigen with calponin homology and coiled-coil domains 1-like
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1020s21c1
Sequence:CCGCTAGAGCAAAGGCTGGACAATTCTCGAGAATTGTCCAGCCTTTGCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153406.3-3601s21c1
Sequence:CCGGCCATTAGCTAGAACTCCTAAACTCGAGTTTAGGAGTTCTAGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153406.3-3788s21c1
Sequence:CCGGTGGAGTGCAAACAGCATAAAGCTCGAGCTTTATGCTGTTTGCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-2491s21c1
Sequence:CCGGAGAAGAGATCGGTGATCTAAACTCGAGTTTAGATCACCGATCTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1716s21c1
Sequence:CCGGTAGGTGTGCAGCAGCATTTAACTCGAGTTAAATGCTGCTGCACACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-3445s21c1
Sequence:CCGGGACGCTGGACATCAATGAAATCTCGAGATTTCATTGATGTCCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153406.3-1619s21c1
Sequence:CCGGGTCATAGATGAAGACGTAAAGCTCGAGCTTTACGTCTTCATCTATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-1797s1c1
Sequence:CCGGGCTGAGTTGTATTCTATCCATCTCGAGATGGATAGAATACAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153406.2-379s1c1
Sequence:CCGGCCAGTTCTACTAGAGAAAGATCTCGAGATCTTTCTCTAGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-2138s1c1
Sequence:CCGGGCTGCATGACAACCTCATTATCTCGAGATAATGAGGTTGTCATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153406.2-3189s1c1
Sequence:CCGGCCAGCCCACATACCATATCAACTCGAGTTGATATGGTATGTGGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015330
SPECC1L MISSION shRNA Bacterial Glycerol Stock
sperm antigen with calponin homology and coiled-coil domains 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-3462s1c1
Sequence:CCGGGCTGAAAGTGTCGGCATCAAACTCGAGTTTGATGCCGACACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-3422s1c1
Sequence:CCGGCCAGGATAAGAGAAGGAACTTCTCGAGAAGTTCCTTCTCTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-1065s1c1
Sequence:CCGGCAGAGGTTAGACAATTCTGAACTCGAGTTCAGAATTGTCTAACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-1583s1c1
Sequence:CCGGGAGCGATAAGTTGGAACACTTCTCGAGAAGTGTTCCAACTTATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015330.1-4827s1c1
Sequence:CCGGGCCAGAACTCAACAGCTATTTCTCGAGAAATAGCTGTTGAGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-2126s1c1
Sequence:CCGGCCGAAATGATGCCAATCGATTCTCGAGAATCGATTGGCATCATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-1905s1c1
Sequence:CCGGGCCACGTTAGAGGAATACAAACTCGAGTTTGTATTCCTCTAACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-506s1c1
Sequence:CCGGCGTGGAGAACAAATCCAAGATCTCGAGATCTTGGATTTGTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015330.1-5429s1c1
Sequence:CCGGCCACTGATGTTCATGTGAGAACTCGAGTTCTCACATGAACATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015330
SPECC1L MISSION shRNA shRNA Plasmid DNA
sperm antigen with calponin homology and coiled-coil domains 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-3462s1c1
Sequence:CCGGGCTGAAAGTGTCGGCATCAAACTCGAGTTTGATGCCGACACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-3422s1c1
Sequence:CCGGCCAGGATAAGAGAAGGAACTTCTCGAGAAGTTCCTTCTCTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-1065s1c1
Sequence:CCGGCAGAGGTTAGACAATTCTGAACTCGAGTTCAGAATTGTCTAACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-1583s1c1
Sequence:CCGGGAGCGATAAGTTGGAACACTTCTCGAGAAGTGTTCCAACTTATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015330.1-4827s1c1
Sequence:CCGGGCCAGAACTCAACAGCTATTTCTCGAGAAATAGCTGTTGAGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-2126s1c1
Sequence:CCGGCCGAAATGATGCCAATCGATTCTCGAGAATCGATTGGCATCATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-1905s1c1
Sequence:CCGGGCCACGTTAGAGGAATACAAACTCGAGTTTGTATTCCTCTAACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-506s1c1
Sequence:CCGGCGTGGAGAACAAATCCAAGATCTCGAGATCTTGGATTTGTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015330.1-5429s1c1
Sequence:CCGGCCACTGATGTTCATGTGAGAACTCGAGTTCTCACATGAACATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015330
SPECC1L MISSION shRNA Lentiviral Transduction Particles
sperm antigen with calponin homology and coiled-coil domains 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-3462s1c1
Sequence:CCGGGCTGAAAGTGTCGGCATCAAACTCGAGTTTGATGCCGACACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-3422s1c1
Sequence:CCGGCCAGGATAAGAGAAGGAACTTCTCGAGAAGTTCCTTCTCTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-1065s1c1
Sequence:CCGGCAGAGGTTAGACAATTCTGAACTCGAGTTCAGAATTGTCTAACCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-1583s1c1
Sequence:CCGGGAGCGATAAGTTGGAACACTTCTCGAGAAGTGTTCCAACTTATCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015330.1-4827s1c1
Sequence:CCGGGCCAGAACTCAACAGCTATTTCTCGAGAAATAGCTGTTGAGTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-2126s1c1
Sequence:CCGGCCGAAATGATGCCAATCGATTCTCGAGAATCGATTGGCATCATTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015330.1-1905s1c1
Sequence:CCGGGCCACGTTAGAGGAATACAAACTCGAGTTTGTATTCCTCTAACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015330.1-506s1c1
Sequence:CCGGCGTGGAGAACAAATCCAAGATCTCGAGATCTTGGATTTGTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155846    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015330.1-5429s1c1
Sequence:CCGGCCACTGATGTTCATGTGAGAACTCGAGTTCTCACATGAACATCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks