EMAIL THIS PAGE TO A FRIEND

SPEF1

sperm flagellar 1

Synonyms: C20orf28 CLAMP SPEF1A
UniProtKB ID: Q9Y4P9, A5YM71, D3DVY0, Q5JX78
Gene ID:
Mouse(70997) sperm flagellar 1
cow(512410) sperm flagellar 1
sheep(101120936) sperm flagellar 1
naked mole-rat(101700357) sperm flagellar 1
domestic guinea pig(100717770) sperm flagellar 1
chicken(426178) sperm flagellar 1
domestic cat(101086220) sperm flagellar 1
Horse(100066267) sperm flagellar 1
dog(485792) sperm flagellar 1
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015417 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU206551 MISSION® esiRNA esiRNA targeting mouse Spef1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015417 Rosetta Predictions human pricing
NM_027641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088574 predicted 199
2 SASI_Hs01_00088576 predicted 242
3 SASI_Hs01_00088577 predicted 589
4 SASI_Hs01_00088578 predicted 565
5 SASI_Hs01_00088579 predicted 416
6 SASI_Hs01_00088580 predicted 1121
7 SASI_Hs02_00347797 predicted 250
8 SASI_Hs01_00088581 predicted 267
9 SASI_Hs01_00088582 predicted 204
10 SASI_Hs02_00347798 predicted 1293
11 SASI_Hs01_00088575 predicted 396
12 SASI_Hs01_00088583 predicted 1303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332513 predicted 402
2 SASI_Mm02_00332514 predicted 760
3 SASI_Mm02_00332515 predicted 199
4 SASI_Mm02_00332516 predicted 1189
5 SASI_Mm02_00332517 predicted 1178
6 SASI_Mm02_00332518 predicted 1269
7 SASI_Mm02_00332519 predicted 754
8 SASI_Mm02_00332520 predicted 724
9 SASI_Mm02_00332521 predicted 372
10 SASI_Mm02_00332522 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015417
SPEF1 MISSION shRNA Bacterial Glycerol Stock
sperm flagellar 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015417.2-1481s1c1
Sequence:CCGGCAAAGCAGTGTCCAACACCTTCTCGAGAAGGTGTTGGACACTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-239s1c1
Sequence:CCGGCTTGTTGCAGAGGTCATCAAGCTCGAGCTTGATGACCTCTGCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-583s1c1
Sequence:CCGGGCTTTCCTTCTGTCCTTCTTCCTCGAGGAAGAAGGACAGAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-748s1c1
Sequence:CCGGCAGGTAAAGAAGCTGGGAGTTCTCGAGAACTCCCAGCTTCTTTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-349s1c1
Sequence:CCGGGAAGGTACTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-532s1c1
Sequence:CCGGCTACATGGATGTGGGTAAGGTCTCGAGACCTTACCCACATCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-353s1c1
Sequence:CCGGGTACTGAAGAGGCTGAACTTTCTCGAGAAAGTTCAGCCTCTTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-278s1c1
Sequence:CCGGGTGGAGATGCACAATTATGTCCTCGAGGACATAATTGTGCATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015417.4-424s21c1
Sequence:CCGGGATGACGTGATGCGCAAGATCCTCGAGGATCTTGCGCATCACGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015417.4-713s21c1
Sequence:CCGGTCGTCCTCCAGATCGCTGAAACTCGAGTTTCAGCGATCTGGAGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015417
SPEF1 MISSION shRNA shRNA Plasmid DNA
sperm flagellar 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015417.2-1481s1c1
Sequence:CCGGCAAAGCAGTGTCCAACACCTTCTCGAGAAGGTGTTGGACACTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-239s1c1
Sequence:CCGGCTTGTTGCAGAGGTCATCAAGCTCGAGCTTGATGACCTCTGCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-583s1c1
Sequence:CCGGGCTTTCCTTCTGTCCTTCTTCCTCGAGGAAGAAGGACAGAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-748s1c1
Sequence:CCGGCAGGTAAAGAAGCTGGGAGTTCTCGAGAACTCCCAGCTTCTTTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-349s1c1
Sequence:CCGGGAAGGTACTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-532s1c1
Sequence:CCGGCTACATGGATGTGGGTAAGGTCTCGAGACCTTACCCACATCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-353s1c1
Sequence:CCGGGTACTGAAGAGGCTGAACTTTCTCGAGAAAGTTCAGCCTCTTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-278s1c1
Sequence:CCGGGTGGAGATGCACAATTATGTCCTCGAGGACATAATTGTGCATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015417.4-424s21c1
Sequence:CCGGGATGACGTGATGCGCAAGATCCTCGAGGATCTTGCGCATCACGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015417.4-713s21c1
Sequence:CCGGTCGTCCTCCAGATCGCTGAAACTCGAGTTTCAGCGATCTGGAGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015417
SPEF1 MISSION shRNA Lentiviral Transduction Particles
sperm flagellar 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015417.2-1481s1c1
Sequence:CCGGCAAAGCAGTGTCCAACACCTTCTCGAGAAGGTGTTGGACACTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165103    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-239s1c1
Sequence:CCGGCTTGTTGCAGAGGTCATCAAGCTCGAGCTTGATGACCTCTGCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-583s1c1
Sequence:CCGGGCTTTCCTTCTGTCCTTCTTCCTCGAGGAAGAAGGACAGAAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-748s1c1
Sequence:CCGGCAGGTAAAGAAGCTGGGAGTTCTCGAGAACTCCCAGCTTCTTTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-349s1c1
Sequence:CCGGGAAGGTACTGAAGAGGCTGAACTCGAGTTCAGCCTCTTCAGTACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-532s1c1
Sequence:CCGGCTACATGGATGTGGGTAAGGTCTCGAGACCTTACCCACATCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-353s1c1
Sequence:CCGGGTACTGAAGAGGCTGAACTTTCTCGAGAAAGTTCAGCCTCTTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015417.2-278s1c1
Sequence:CCGGGTGGAGATGCACAATTATGTCCTCGAGGACATAATTGTGCATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015417.4-424s21c1
Sequence:CCGGGATGACGTGATGCGCAAGATCCTCGAGGATCTTGCGCATCACGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015417.4-713s21c1
Sequence:CCGGTCGTCCTCCAGATCGCTGAAACTCGAGTTTCAGCGATCTGGAGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027641
SPEF1 MISSION shRNA Bacterial Glycerol Stock
sperm flagellar 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-175s21c1
Sequence:CCGGTGTACCTCTGGGTAGACAATACTCGAGTATTGTCTACCCAGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-285s21c1
Sequence:CCGGATGGTGGAGATGCACAATTATCTCGAGATAATTGTGCATCTCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-761s21c1
Sequence:CCGGGGAACATCTGCTCCAACTTAACTCGAGTTAAGTTGGAGCAGATGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027641.2-1585s21c1
Sequence:CCGGTAGACCCTGTGGGCCTATTATCTCGAGATAATAGGCCCACAGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-394s21c1
Sequence:CCGGACGATGTGATGCGGAAGATTGCTCGAGCAATCTTCCGCATCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027641
SPEF1 MISSION shRNA shRNA Plasmid DNA
sperm flagellar 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-175s21c1
Sequence:CCGGTGTACCTCTGGGTAGACAATACTCGAGTATTGTCTACCCAGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-285s21c1
Sequence:CCGGATGGTGGAGATGCACAATTATCTCGAGATAATTGTGCATCTCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-761s21c1
Sequence:CCGGGGAACATCTGCTCCAACTTAACTCGAGTTAAGTTGGAGCAGATGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027641.2-1585s21c1
Sequence:CCGGTAGACCCTGTGGGCCTATTATCTCGAGATAATAGGCCCACAGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-394s21c1
Sequence:CCGGACGATGTGATGCGGAAGATTGCTCGAGCAATCTTCCGCATCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027641
SPEF1 MISSION shRNA Lentiviral Transduction Particles
sperm flagellar 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-175s21c1
Sequence:CCGGTGTACCTCTGGGTAGACAATACTCGAGTATTGTCTACCCAGAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-285s21c1
Sequence:CCGGATGGTGGAGATGCACAATTATCTCGAGATAATTGTGCATCTCCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-761s21c1
Sequence:CCGGGGAACATCTGCTCCAACTTAACTCGAGTTAAGTTGGAGCAGATGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027641.2-1585s21c1
Sequence:CCGGTAGACCCTGTGGGCCTATTATCTCGAGATAATAGGCCCACAGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027641.2-394s21c1
Sequence:CCGGACGATGTGATGCGGAAGATTGCTCGAGCAATCTTCCGCATCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks