EMAIL THIS PAGE TO A FRIEND

SPEF2

sperm flagellar 2

Synonyms: CT122 KPL2
UniProtKB ID: Q9C093, Q2TAC9, Q96LL6, Q9H5C7, Q9H5Q7
Gene ID:
Mouse(320277) sperm flagellar 2
Rat(64555) sperm flagellar 2
Zebrafish(553375) sperm flagellar 2
dog(489235) sperm flagellar 2
Horse(100067964) sperm flagellar 2
domestic cat(101100945) sperm flagellar 2
chicken(427435) sperm flagellar 2
domestic guinea pig(100721801) sperm flagellar 2
naked mole-rat(101710798) sperm flagellar 2
cow(100337039) sperm flagellar 2
sheep(101111394) sperm flagellar 2
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177123 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177123 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177123 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144722 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024867 Rosetta Predictions human pricing
NM_144722 Rosetta Predictions human pricing
NM_022620 Rosetta Predictions rat pricing
NM_177123 Rosetta Predictions mouse pricing
XM_484441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210613 predicted 533
2 SASI_Hs02_00357454 predicted 458
3 SASI_Hs02_00357455 predicted 1322
4 SASI_Hs01_00210616 predicted 396
5 SASI_Hs01_00210617 predicted 1089
6 SASI_Hs01_00210618 predicted 1302
7 SASI_Hs01_00210619 predicted 387
8 SASI_Hs01_00210620 predicted 543
9 SASI_Hs01_00210621 predicted 1064
10 SASI_Hs01_00210622 predicted 1235
11 SASI_Hs01_00210614 predicted 1044
12 SASI_Hs01_00210615 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218509 predicted 531
2 SASI_Hs02_00364670 predicted 460
3 SASI_Hs02_00364671 predicted 1331
4 SASI_Hs01_00218512 predicted 391
5 SASI_Hs01_00218513 predicted 1089
6 SASI_Hs01_00218514 predicted 1304
7 SASI_Hs01_00218515 predicted 387
8 SASI_Hs01_00218516 predicted 542
9 SASI_Hs01_00218517 predicted 1055
10 SASI_Hs01_00218518 predicted 1237
11 SASI_Hs01_00218510 predicted 1043
12 SASI_Hs01_00218511 predicted 1361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106167 predicted 1776
2 SASI_Rn02_00263404 predicted 2224
3 SASI_Rn01_00106168 predicted 3092
4 SASI_Rn01_00106169 predicted 1991
5 SASI_Rn01_00106170 predicted 3074
6 SASI_Rn01_00106171 predicted 634
7 SASI_Rn01_00106172 predicted 4800
8 SASI_Rn02_00263405 predicted 2799
9 SASI_Rn01_00106173 predicted 1259
10 SASI_Rn01_00106174 predicted 4231
11 SASI_Rn01_00106175 predicted 5124
12 SASI_Rn01_00106176 predicted 490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347109 predicted 1352
2 SASI_Mm02_00347110 predicted 604
3 SASI_Mm02_00347111 predicted 2666
4 SASI_Mm02_00347112 predicted 1407
5 SASI_Mm02_00347113 predicted 199
6 SASI_Mm02_00347114 predicted 1224
7 SASI_Mm02_00347115 predicted 2285
8 SASI_Mm02_00347116 predicted 1921
9 SASI_Mm02_00347117 predicted 218
10 SASI_Mm02_00347118 predicted 2668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271230 predicted 1412
2 SASI_Mm01_00271231 predicted 670
3 SASI_Mm01_00271232 predicted 3897
4 SASI_Mm01_00271233 predicted 4202
5 SASI_Mm01_00271234 predicted 1472
6 SASI_Mm01_00271235 predicted 1297
7 SASI_Mm01_00271236 predicted 3129
8 SASI_Mm01_00271237 predicted 2345
9 SASI_Mm01_00271238 predicted 2889
10 SASI_Mm01_00271239 predicted 1991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177123
SPEF2 MISSION shRNA Bacterial Glycerol Stock
sperm flagellar 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-1538s21c1
Sequence:CCGGCTTGCGGTCAAGGGTTGTATACTCGAGTATACAACCCTTGACCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-443s21c1
Sequence:CCGGTTTCGAGAGCAACGCTTAAACCTCGAGGTTTAAGCGTTGCTCTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-1115s21c1
Sequence:CCGGAGAGCCCAACAGCGTTATAAGCTCGAGCTTATAACGCTGTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-2204s21c1
Sequence:CCGGTCATCGTTGGCTCGAACTAATCTCGAGATTAGTTCGAGCCAACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177123.3-2669s21c1
Sequence:CCGGAGTGATCTGTAATCCTATTTGCTCGAGCAAATAGGATTACAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177123
SPEF2 MISSION shRNA shRNA Plasmid DNA
sperm flagellar 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-1538s21c1
Sequence:CCGGCTTGCGGTCAAGGGTTGTATACTCGAGTATACAACCCTTGACCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-443s21c1
Sequence:CCGGTTTCGAGAGCAACGCTTAAACCTCGAGGTTTAAGCGTTGCTCTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-1115s21c1
Sequence:CCGGAGAGCCCAACAGCGTTATAAGCTCGAGCTTATAACGCTGTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-2204s21c1
Sequence:CCGGTCATCGTTGGCTCGAACTAATCTCGAGATTAGTTCGAGCCAACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177123.3-2669s21c1
Sequence:CCGGAGTGATCTGTAATCCTATTTGCTCGAGCAAATAGGATTACAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177123
SPEF2 MISSION shRNA Lentiviral Transduction Particles
sperm flagellar 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-1538s21c1
Sequence:CCGGCTTGCGGTCAAGGGTTGTATACTCGAGTATACAACCCTTGACCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-443s21c1
Sequence:CCGGTTTCGAGAGCAACGCTTAAACCTCGAGGTTTAAGCGTTGCTCTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-1115s21c1
Sequence:CCGGAGAGCCCAACAGCGTTATAAGCTCGAGCTTATAACGCTGTTGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177123.3-2204s21c1
Sequence:CCGGTCATCGTTGGCTCGAACTAATCTCGAGATTAGTTCGAGCCAACGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177123.3-2669s21c1
Sequence:CCGGAGTGATCTGTAATCCTATTTGCTCGAGCAAATAGGATTACAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144722
SPEF2 MISSION shRNA Bacterial Glycerol Stock
sperm flagellar 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144722.2-1537s1c1
Sequence:CCGGGCCTCTGTTAAGACACTACCTCTCGAGAGGTAGTGTCTTAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144722.2-571s1c1
Sequence:CCGGCGGATTACATACAGGTTTCAACTCGAGTTGAAACCTGTATGTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144722.2-1600s1c1
Sequence:CCGGGACTTGCTAGATACCAATGATCTCGAGATCATTGGTATCTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2405s1c1
Sequence:CCGGCCCTTAGAAGTAAAGGTGTAACTCGAGTTACACCTTTACTTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2152s1c1
Sequence:CCGGCCTTTGAGATTAGACAGACTACTCGAGTAGTCTGTCTAATCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2222s1c1
Sequence:CCGGCCAGTTCATTAAGGGCTAATACTCGAGTATTAGCCCTTAATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144722
SPEF2 MISSION shRNA shRNA Plasmid DNA
sperm flagellar 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144722.2-1537s1c1
Sequence:CCGGGCCTCTGTTAAGACACTACCTCTCGAGAGGTAGTGTCTTAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144722.2-571s1c1
Sequence:CCGGCGGATTACATACAGGTTTCAACTCGAGTTGAAACCTGTATGTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144722.2-1600s1c1
Sequence:CCGGGACTTGCTAGATACCAATGATCTCGAGATCATTGGTATCTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2405s1c1
Sequence:CCGGCCCTTAGAAGTAAAGGTGTAACTCGAGTTACACCTTTACTTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2152s1c1
Sequence:CCGGCCTTTGAGATTAGACAGACTACTCGAGTAGTCTGTCTAATCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2222s1c1
Sequence:CCGGCCAGTTCATTAAGGGCTAATACTCGAGTATTAGCCCTTAATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144722
SPEF2 MISSION shRNA Lentiviral Transduction Particles
sperm flagellar 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144722.2-1537s1c1
Sequence:CCGGGCCTCTGTTAAGACACTACCTCTCGAGAGGTAGTGTCTTAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144722.2-571s1c1
Sequence:CCGGCGGATTACATACAGGTTTCAACTCGAGTTGAAACCTGTATGTAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144722.2-1600s1c1
Sequence:CCGGGACTTGCTAGATACCAATGATCTCGAGATCATTGGTATCTAGCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2405s1c1
Sequence:CCGGCCCTTAGAAGTAAAGGTGTAACTCGAGTTACACCTTTACTTCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2152s1c1
Sequence:CCGGCCTTTGAGATTAGACAGACTACTCGAGTAGTCTGTCTAATCTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152229    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144722.2-2222s1c1
Sequence:CCGGCCAGTTCATTAAGGGCTAATACTCGAGTATTAGCCCTTAATGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks