EMAIL THIS PAGE TO A FRIEND

SPEG

SPEG complex locus

Synonyms: APEG-1 APEG1 BPEG SPEGalpha SPEGbeta
Gene ID:
Human(10290) Summary: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies in mouse have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants have been reported for this gene, but the full-length nature of only two variants that encode different protein isoforms has been defined. [provided by RefSeq, Mar 2010]
Mouse(11790) SPEG complex locus
Rat(363256) SPEG complex locus
cow(523490) SPEG complex locus
sheep(101117564) SPEG complex locus
naked mole-rat(101713917) SPEG complex locus
Domestic Rabbit(100328891) SPEG complex locus
domestic guinea pig(100733194) SPEG complex locus
Zebrafish(570504) SPEG complex locus
Horse(100056385) SPEG complex locus
domestic cat(101101154) SPEG complex locus
dog(478924) SPEG complex locus
chicken(101751406) SPEG complex locus
chicken(429033) SPEG complex locus
197 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_001128413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001128413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001128413 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU086571 MISSION® esiRNA esiRNA targeting mouse Speg (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005876 Rosetta Predictions human pricing
NM_001108802 Rosetta Predictions rat pricing
NM_001085370 Rosetta Predictions mouse pricing
NM_001085371 Rosetta Predictions mouse pricing
NM_007463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340458 predicted 6952
2 SASI_Hs02_00340459 predicted 3803
3 SASI_Hs02_00340460 predicted 5413
4 SASI_Hs02_00340461 predicted 2620
5 SASI_Hs02_00340462 predicted 9370
6 SASI_Hs02_00340463 predicted 5265
7 SASI_Hs02_00340464 predicted 2614
8 SASI_Hs02_00340465 predicted 9579
9 SASI_Hs02_00340466 predicted 5279
10 SASI_Hs02_00340467 predicted 5275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242215 predicted 5562
2 SASI_Rn02_00242216 predicted 9369
3 SASI_Rn02_00242217 predicted 4929
4 SASI_Rn02_00242218 predicted 3865
5 SASI_Rn02_00242219 predicted 2370
6 SASI_Rn02_00242220 predicted 5052
7 SASI_Rn02_00242221 predicted 2366
8 SASI_Rn02_00242222 predicted 1018
9 SASI_Rn02_00242223 predicted 7856
10 SASI_Rn02_00242224 predicted 2771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300215 predicted 1653
2 SASI_Mm02_00300216 predicted 1900
3 SASI_Mm02_00300217 predicted 1860
4 SASI_Mm02_00300218 predicted 1465
5 SASI_Mm02_00300219 predicted 1471
6 SASI_Mm02_00300220 predicted 1803
7 SASI_Mm02_00300221 predicted 1880
8 SASI_Mm02_00300222 predicted 1799
9 SASI_Mm02_00300223 predicted 1532
10 SASI_Mm02_00300224 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300225 predicted 2119
2 SASI_Mm02_00300226 predicted 1389
3 SASI_Mm02_00300227 predicted 2332
4 SASI_Mm02_00300228 predicted 1620
5 SASI_Mm02_00300229 predicted 1935
6 SASI_Mm02_00300230 predicted 1886
7 SASI_Mm02_00300231 predicted 1503
8 SASI_Mm02_00300232 predicted 1685
9 SASI_Mm02_00300233 predicted 2344
10 SASI_Mm02_00300234 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311664 predicted 2553
2 SASI_Mm02_00311665 predicted 1821
3 SASI_Mm02_00311666 predicted 2760
4 SASI_Mm02_00311667 predicted 2054
5 SASI_Mm01_00115034 predicted 2371
6 SASI_Mm02_00311668 predicted 2316
7 SASI_Mm02_00311669 predicted 1933
8 SASI_Mm02_00311670 predicted 2119
9 SASI_Mm02_00311671 predicted 2783
10 SASI_Mm02_00311672 predicted 1354
11 SASI_Mm01_00115030 predicted 4943
12 SASI_Mm01_00115031 predicted 9387
13 SASI_Mm01_00115032 predicted 5571
14 SASI_Mm01_00115033 predicted 5586
15 SASI_Mm01_00115035 predicted 3737
16 SASI_Mm01_00115036 predicted 3872
17 SASI_Mm01_00115037 predicted 7873
18 SASI_Mm01_00115038 predicted 9633
19 SASI_Mm01_00115039 predicted 9455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005876
VALIDATED
SPEG MISSION shRNA Bacterial Glycerol Stock
SPEG complex locus
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005876.3-2604s1c1
Sequence:CCGGCCACCTTCAAGGTCTCACTTACTCGAGTAAGTGAGACCTTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005876.3-2815s1c1
Sequence:CCGGCTACACTTGCAAAGCGGTCAACTCGAGTTGACCGCTTTGCAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005876.3-2618s1c1
Sequence:CCGGTCACTTATGGACCAGTCAGTACTCGAGTACTGACTGGTCCATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005876.3-2797s1c1
Sequence:CCGGGCGTGGCGATGCTGGTTTCTACTCGAGTAGAAACCAGCATCGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005876.3-2647s1c1
Sequence:CCGGCCAAGATGTCATCATGAGCATCTCGAGATGCTCATGATGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-5530s21c1
Sequence:CCGGACCGCAGAAGAGACCCTAGAACTCGAGTTCTAGGGTCTCTTCTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-5285s21c1
Sequence:CCGGAGTTTGTAGCACCCGAGATTGCTCGAGCAATCTCGGGTGCTACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-4181s21c1
Sequence:CCGGACAAACCAGACATCGTGTATGCTCGAGCATACACGATGTCTGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3279s21c1
Sequence:CCGGTGTTGTTACCTGGACTCATTTCTCGAGAAATGAGTCCAGGTAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3399s21c1
Sequence:CCGGCTATGCGGTCAGTGCTGTTAACTCGAGTTAACAGCACTGACCGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3767s21c1
Sequence:CCGGGTGTCTACAAGAGCGTCATTGCTCGAGCAATGACGCTCTTGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-7838s21c1
Sequence:CCGGCGCACATCTCCTGGATGAAAGCTCGAGCTTTCATCCAGGAGATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-9441s21c1
Sequence:CCGGGGGTGTGCTCACTTACATTATCTCGAGATAATGTAAGTGAGCACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-8282s21c1
Sequence:CCCGACTCTTCTGAGAAGGTCTTTGCTCGAGCAAAGACCTTCTCAGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005876
VALIDATED
SPEG MISSION shRNA shRNA Plasmid DNA
SPEG complex locus
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005876.3-2604s1c1
Sequence:CCGGCCACCTTCAAGGTCTCACTTACTCGAGTAAGTGAGACCTTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005876.3-2815s1c1
Sequence:CCGGCTACACTTGCAAAGCGGTCAACTCGAGTTGACCGCTTTGCAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005876.3-2618s1c1
Sequence:CCGGTCACTTATGGACCAGTCAGTACTCGAGTACTGACTGGTCCATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005876.3-2797s1c1
Sequence:CCGGGCGTGGCGATGCTGGTTTCTACTCGAGTAGAAACCAGCATCGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005876.3-2647s1c1
Sequence:CCGGCCAAGATGTCATCATGAGCATCTCGAGATGCTCATGATGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-5530s21c1
Sequence:CCGGACCGCAGAAGAGACCCTAGAACTCGAGTTCTAGGGTCTCTTCTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-5285s21c1
Sequence:CCGGAGTTTGTAGCACCCGAGATTGCTCGAGCAATCTCGGGTGCTACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-4181s21c1
Sequence:CCGGACAAACCAGACATCGTGTATGCTCGAGCATACACGATGTCTGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3279s21c1
Sequence:CCGGTGTTGTTACCTGGACTCATTTCTCGAGAAATGAGTCCAGGTAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3399s21c1
Sequence:CCGGCTATGCGGTCAGTGCTGTTAACTCGAGTTAACAGCACTGACCGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3767s21c1
Sequence:CCGGGTGTCTACAAGAGCGTCATTGCTCGAGCAATGACGCTCTTGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-7838s21c1
Sequence:CCGGCGCACATCTCCTGGATGAAAGCTCGAGCTTTCATCCAGGAGATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-9441s21c1
Sequence:CCGGGGGTGTGCTCACTTACATTATCTCGAGATAATGTAAGTGAGCACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-8282s21c1
Sequence:CCCGACTCTTCTGAGAAGGTCTTTGCTCGAGCAAAGACCTTCTCAGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005876
VALIDATED
SPEG MISSION shRNA Lentiviral Transduction Particles
SPEG complex locus
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005876.3-2604s1c1
Sequence:CCGGCCACCTTCAAGGTCTCACTTACTCGAGTAAGTGAGACCTTGAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_005876.3-2815s1c1
Sequence:CCGGCTACACTTGCAAAGCGGTCAACTCGAGTTGACCGCTTTGCAAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005876.3-2618s1c1
Sequence:CCGGTCACTTATGGACCAGTCAGTACTCGAGTACTGACTGGTCCATAAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_005876.3-2797s1c1
Sequence:CCGGGCGTGGCGATGCTGGTTTCTACTCGAGTAGAAACCAGCATCGCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005876.3-2647s1c1
Sequence:CCGGCCAAGATGTCATCATGAGCATCTCGAGATGCTCATGATGACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-5530s21c1
Sequence:CCGGACCGCAGAAGAGACCCTAGAACTCGAGTTCTAGGGTCTCTTCTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-5285s21c1
Sequence:CCGGAGTTTGTAGCACCCGAGATTGCTCGAGCAATCTCGGGTGCTACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-4181s21c1
Sequence:CCGGACAAACCAGACATCGTGTATGCTCGAGCATACACGATGTCTGGTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3279s21c1
Sequence:CCGGTGTTGTTACCTGGACTCATTTCTCGAGAAATGAGTCCAGGTAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3399s21c1
Sequence:CCGGCTATGCGGTCAGTGCTGTTAACTCGAGTTAACAGCACTGACCGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-3767s21c1
Sequence:CCGGGTGTCTACAAGAGCGTCATTGCTCGAGCAATGACGCTCTTGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-7838s21c1
Sequence:CCGGCGCACATCTCCTGGATGAAAGCTCGAGCTTTCATCCAGGAGATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-9441s21c1
Sequence:CCGGGGGTGTGCTCACTTACATTATCTCGAGATAATGTAAGTGAGCACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005876.4-8282s21c1
Sequence:CCCGACTCTTCTGAGAAGGTCTTTGCTCGAGCAAAGACCTTCTCAGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007463
SPEG MISSION shRNA Bacterial Glycerol Stock
SPEG complex locus
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007463.2-10608s1c1
Sequence:CCGGGCCCTCCTTCCCATTTGTATTCTCGAGAATACAAATGGGAAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-3921s1c1
Sequence:CCGGGCTGGTGTCTATAAGAGTGTACTCGAGTACACTCTTATAGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5586s1c1
Sequence:CCGGCGAAACTACAACGTGGCATTTCTCGAGAAATGCCACGTTGTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5792s1c1
Sequence:CCGGGCGCTCTCAAATCAGCTACAACTCGAGTTGTAGCTGATTTGAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5585s1c1
Sequence:CCGGCCGAAACTACAACGTGGCATTCTCGAGAATGCCACGTTGTAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-2983s21c1
Sequence:CCGGGCAAGGCGGTCAACGAATATGCTCGAGCATATTCGTTGACCGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-3437s21c1
Sequence:CCGGCTCCGTTACCTGGACTCATTTCTCGAGAAATGAGTCCAGGTAACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-9281s21c1
Sequence:CCGGCAGCGACAGATTCCGGTATTCCTCGAGGAATACCGGAATCTGTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007463
SPEG MISSION shRNA shRNA Plasmid DNA
SPEG complex locus
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007463.2-10608s1c1
Sequence:CCGGGCCCTCCTTCCCATTTGTATTCTCGAGAATACAAATGGGAAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-3921s1c1
Sequence:CCGGGCTGGTGTCTATAAGAGTGTACTCGAGTACACTCTTATAGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5586s1c1
Sequence:CCGGCGAAACTACAACGTGGCATTTCTCGAGAAATGCCACGTTGTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5792s1c1
Sequence:CCGGGCGCTCTCAAATCAGCTACAACTCGAGTTGTAGCTGATTTGAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5585s1c1
Sequence:CCGGCCGAAACTACAACGTGGCATTCTCGAGAATGCCACGTTGTAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-2983s21c1
Sequence:CCGGGCAAGGCGGTCAACGAATATGCTCGAGCATATTCGTTGACCGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-3437s21c1
Sequence:CCGGCTCCGTTACCTGGACTCATTTCTCGAGAAATGAGTCCAGGTAACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-9281s21c1
Sequence:CCGGCAGCGACAGATTCCGGTATTCCTCGAGGAATACCGGAATCTGTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007463
SPEG MISSION shRNA Lentiviral Transduction Particles
SPEG complex locus
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007463.2-10608s1c1
Sequence:CCGGGCCCTCCTTCCCATTTGTATTCTCGAGAATACAAATGGGAAGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-3921s1c1
Sequence:CCGGGCTGGTGTCTATAAGAGTGTACTCGAGTACACTCTTATAGACACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5586s1c1
Sequence:CCGGCGAAACTACAACGTGGCATTTCTCGAGAAATGCCACGTTGTAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5792s1c1
Sequence:CCGGGCGCTCTCAAATCAGCTACAACTCGAGTTGTAGCTGATTTGAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007463.2-5585s1c1
Sequence:CCGGCCGAAACTACAACGTGGCATTCTCGAGAATGCCACGTTGTAGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-2983s21c1
Sequence:CCGGGCAAGGCGGTCAACGAATATGCTCGAGCATATTCGTTGACCGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-3437s21c1
Sequence:CCGGCTCCGTTACCTGGACTCATTTCTCGAGAAATGAGTCCAGGTAACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007463.4-9281s21c1
Sequence:CCGGCAGCGACAGATTCCGGTATTCCTCGAGGAATACCGGAATCTGTCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001128413
VALIDATED
SPEG MISSION shRNA Bacterial Glycerol Stock
SPEG complex locus
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000199850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001128413.1-4894s1c1
Sequence:CCGGCCGGACATCATGTGGTACAAGCTCGAGCTTGTACCACATGATGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_001128413.1-10445s1c1
Sequence:CCGGCCAAGCTCACTTGCCGCATTTCTCGAGAAATGCGGCAAGTGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_001128413.1-10222s1c1
Sequence:CCGGGCTGGATCTCTTATGTCTAAACTCGAGTTTAGACATAAGAGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001128413.1-728s1c1
Sequence:CCGGGAAAGCAAAGTTACGACTCAGCTCGAGCTGAGTCGTAACTTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001128413
VALIDATED
SPEG MISSION shRNA shRNA Plasmid DNA
SPEG complex locus
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000199850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001128413.1-4894s1c1
Sequence:CCGGCCGGACATCATGTGGTACAAGCTCGAGCTTGTACCACATGATGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_001128413.1-10445s1c1
Sequence:CCGGCCAAGCTCACTTGCCGCATTTCTCGAGAAATGCGGCAAGTGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_001128413.1-10222s1c1
Sequence:CCGGGCTGGATCTCTTATGTCTAAACTCGAGTTTAGACATAAGAGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001128413.1-728s1c1
Sequence:CCGGGAAAGCAAAGTTACGACTCAGCTCGAGCTGAGTCGTAACTTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001128413
VALIDATED
SPEG MISSION shRNA Lentiviral Transduction Particles
SPEG complex locus
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000199850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001128413.1-4894s1c1
Sequence:CCGGCCGGACATCATGTGGTACAAGCTCGAGCTTGTACCACATGATGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_001128413.1-10445s1c1
Sequence:CCGGCCAAGCTCACTTGCCGCATTTCTCGAGAAATGCGGCAAGTGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:XM_001128413.1-10222s1c1
Sequence:CCGGGCTGGATCTCTTATGTCTAAACTCGAGTTTAGACATAAGAGATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_001128413.1-728s1c1
Sequence:CCGGGAAAGCAAAGTTACGACTCAGCTCGAGCTGAGTCGTAACTTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks