EMAIL THIS PAGE TO A FRIEND

SPEM1

spermatid maturation 1

Synonyms: C17orf83
UniProtKB ID: Q8N4L4
Gene ID:
Mouse(74288) sperm maturation 1
Rat(691981) spermatid maturation 1
dog(607805) spermatid maturation 1
domestic cat(101097769) spermatid maturation 1
domestic guinea pig(100714930) spermatid maturation 1
naked mole-rat(101722000) spermatid maturation 1
cow(511321) spermatid maturation 1
sheep(101120848) spermatid maturation 1
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303971 ANTI-SPEM1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199339 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151851 MISSION® esiRNA esiRNA human SPEM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199339 Rosetta Predictions human pricing
NM_001109653 Rosetta Predictions rat pricing
NM_028855 Rosetta Predictions mouse pricing
XM_126335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372768 predicted 614
2 SASI_Hs02_00372769 predicted 408
3 SASI_Hs01_00011779 predicted 232
4 SASI_Hs02_00372770 predicted 618
5 SASI_Hs01_00011785 predicted 309
6 SASI_Hs02_00372771 predicted 613
7 SASI_Hs02_00372772 predicted 619
8 SASI_Hs02_00372773 predicted 459
9 SASI_Hs02_00372774 predicted 398
10 SASI_Hs02_00372775 predicted 411
11 SASI_Hs01_00011778 predicted 1385
12 SASI_Hs01_00011780 predicted 1406
13 SASI_Hs01_00011781 predicted 1368
14 SASI_Hs01_00011782 predicted 567
15 SASI_Hs01_00011783 predicted 643
16 SASI_Hs01_00011784 predicted 1358
17 SASI_Hs01_00011786 predicted 1430
18 SASI_Hs01_00011787 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250462 predicted 790
2 SASI_Rn02_00250463 predicted 222
3 SASI_Rn02_00250464 predicted 534
4 SASI_Rn02_00250465 predicted 354
5 SASI_Rn02_00250466 predicted 248
6 SASI_Rn02_00250467 predicted 518
7 SASI_Rn02_00250468 predicted 253
8 SASI_Rn02_00250469 predicted 555
9 SASI_Rn02_00250470 predicted 283
10 SASI_Rn02_00250471 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334524 predicted 231
2 SASI_Mm02_00334525 predicted 216
3 SASI_Mm02_00334526 predicted 314
4 SASI_Mm02_00334527 predicted 261
5 SASI_Mm02_00334528 predicted 665
6 SASI_Mm02_00334529 predicted 463
7 SASI_Mm02_00334530 predicted 551
8 SASI_Mm02_00334531 predicted 338
9 SASI_Mm02_00334532 predicted 329
10 SASI_Mm02_00334533 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236125 predicted 241
2 SASI_Mm01_00236126 predicted 253
3 SASI_Mm01_00236127 predicted 230
4 SASI_Mm01_00236128 predicted 289
5 SASI_Mm01_00236129 predicted 242
6 SASI_Mm01_00236130 predicted 249
7 SASI_Mm01_00236131 predicted 236
8 SASI_Mm01_00236132 predicted 291
9 SASI_Mm01_00236133 predicted 235
10 SASI_Mm01_00236134 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028855
SPEM1 MISSION shRNA Bacterial Glycerol Stock
spermatid maturation 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-828s21c1
Sequence:CCGGCGCCATTCATCAGGCCGAATACTCGAGTATTCGGCCTGATGAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-623s21c1
Sequence:CCGGCAGGCCTCTCAAATCGGAAATCTCGAGATTTCCGATTTGAGAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-152s21c1
Sequence:CCGGTCTGCTGCTCTTGGGTCTTATCTCGAGATAAGACCCAAGAGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-178s21c1
Sequence:CCGGGTATTAACATTGGCATCAATTCTCGAGAATTGATGCCAATGTTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-238s21c1
Sequence:CCGGACCGAATGTTCCATATCATTTCTCGAGAAATGATATGGAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028855
SPEM1 MISSION shRNA shRNA Plasmid DNA
spermatid maturation 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-828s21c1
Sequence:CCGGCGCCATTCATCAGGCCGAATACTCGAGTATTCGGCCTGATGAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-623s21c1
Sequence:CCGGCAGGCCTCTCAAATCGGAAATCTCGAGATTTCCGATTTGAGAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-152s21c1
Sequence:CCGGTCTGCTGCTCTTGGGTCTTATCTCGAGATAAGACCCAAGAGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-178s21c1
Sequence:CCGGGTATTAACATTGGCATCAATTCTCGAGAATTGATGCCAATGTTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-238s21c1
Sequence:CCGGACCGAATGTTCCATATCATTTCTCGAGAAATGATATGGAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028855
SPEM1 MISSION shRNA Lentiviral Transduction Particles
spermatid maturation 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-828s21c1
Sequence:CCGGCGCCATTCATCAGGCCGAATACTCGAGTATTCGGCCTGATGAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-623s21c1
Sequence:CCGGCAGGCCTCTCAAATCGGAAATCTCGAGATTTCCGATTTGAGAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-152s21c1
Sequence:CCGGTCTGCTGCTCTTGGGTCTTATCTCGAGATAAGACCCAAGAGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-178s21c1
Sequence:CCGGGTATTAACATTGGCATCAATTCTCGAGAATTGATGCCAATGTTAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028855.1-238s21c1
Sequence:CCGGACCGAATGTTCCATATCATTTCTCGAGAAATGATATGGAACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199339
SPEM1 MISSION shRNA Bacterial Glycerol Stock
spermatid maturation 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1388s1c1
Sequence:CCGGCCTACTTCTCTCATTCAACTACTCGAGTAGTTGAATGAGAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1374s1c1
Sequence:CCGGCGTTTACAAATGGCCCTACTTCTCGAGAAGTAGGGCCATTTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-1373s1c1
Sequence:CCGGCCGTTTACAAATGGCCCTACTCTCGAGAGTAGGGCCATTTGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199339.1-989s1c1
Sequence:CCGGGTAACATCACAGCTCTCTGTGCTCGAGCACAGAGAGCTGTGATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-1265s1c1
Sequence:CCGGGCACACACATACCACTTGAGACTCGAGTCTCAAGTGGTATGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-982s1c1
Sequence:CCGGCCTCACTGTAACATCACAGCTCTCGAGAGCTGTGATGTTACAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-971s1c1
Sequence:CCGGCTCAAGAGGTACCTCACTGTACTCGAGTACAGTGAGGTACCTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199339.1-599s1c1
Sequence:CCGGCCTAAGAAGCAGAGTTCTCCTCTCGAGAGGAGAACTCTGCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1191s1c1
Sequence:CCGGGTGAACTCAGAAACTGAGAAACTCGAGTTTCTCAGTTTCTGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199339.1-564s1c1
Sequence:CCGGCCAAGTCATCATTACTCAGAACTCGAGTTCTGAGTAATGATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1051s1c1
Sequence:CCGGGACTAAGTTCAGAGAAGCTAACTCGAGTTAGCTTCTCTGAACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199339
SPEM1 MISSION shRNA shRNA Plasmid DNA
spermatid maturation 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1388s1c1
Sequence:CCGGCCTACTTCTCTCATTCAACTACTCGAGTAGTTGAATGAGAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1374s1c1
Sequence:CCGGCGTTTACAAATGGCCCTACTTCTCGAGAAGTAGGGCCATTTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-1373s1c1
Sequence:CCGGCCGTTTACAAATGGCCCTACTCTCGAGAGTAGGGCCATTTGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199339.1-989s1c1
Sequence:CCGGGTAACATCACAGCTCTCTGTGCTCGAGCACAGAGAGCTGTGATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-1265s1c1
Sequence:CCGGGCACACACATACCACTTGAGACTCGAGTCTCAAGTGGTATGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-982s1c1
Sequence:CCGGCCTCACTGTAACATCACAGCTCTCGAGAGCTGTGATGTTACAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-971s1c1
Sequence:CCGGCTCAAGAGGTACCTCACTGTACTCGAGTACAGTGAGGTACCTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199339.1-599s1c1
Sequence:CCGGCCTAAGAAGCAGAGTTCTCCTCTCGAGAGGAGAACTCTGCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1191s1c1
Sequence:CCGGGTGAACTCAGAAACTGAGAAACTCGAGTTTCTCAGTTTCTGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199339.1-564s1c1
Sequence:CCGGCCAAGTCATCATTACTCAGAACTCGAGTTCTGAGTAATGATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1051s1c1
Sequence:CCGGGACTAAGTTCAGAGAAGCTAACTCGAGTTAGCTTCTCTGAACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199339
SPEM1 MISSION shRNA Lentiviral Transduction Particles
spermatid maturation 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121747    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1388s1c1
Sequence:CCGGCCTACTTCTCTCATTCAACTACTCGAGTAGTTGAATGAGAGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1374s1c1
Sequence:CCGGCGTTTACAAATGGCCCTACTTCTCGAGAAGTAGGGCCATTTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-1373s1c1
Sequence:CCGGCCGTTTACAAATGGCCCTACTCTCGAGAGTAGGGCCATTTGTAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199339.1-989s1c1
Sequence:CCGGGTAACATCACAGCTCTCTGTGCTCGAGCACAGAGAGCTGTGATGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-1265s1c1
Sequence:CCGGGCACACACATACCACTTGAGACTCGAGTCTCAAGTGGTATGTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-982s1c1
Sequence:CCGGCCTCACTGTAACATCACAGCTCTCGAGAGCTGTGATGTTACAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199339.1-971s1c1
Sequence:CCGGCTCAAGAGGTACCTCACTGTACTCGAGTACAGTGAGGTACCTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199339.1-599s1c1
Sequence:CCGGCCTAAGAAGCAGAGTTCTCCTCTCGAGAGGAGAACTCTGCTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1191s1c1
Sequence:CCGGGTGAACTCAGAAACTGAGAAACTCGAGTTTCTCAGTTTCTGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199339.1-564s1c1
Sequence:CCGGCCAAGTCATCATTACTCAGAACTCGAGTTCTGAGTAATGATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145145    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199339.1-1051s1c1
Sequence:CCGGGACTAAGTTCAGAGAAGCTAACTCGAGTTAGCTTCTCTGAACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks