EMAIL THIS PAGE TO A FRIEND

SPEN

spen homolog, transcriptional regulator (Drosophila)

Synonyms: HIAA0929 MINT RBM15C SHARP
UniProtKB ID: Q96T58, Q9H9A8, Q9NWH5, Q9UQ01, Q9Y556
Gene ID:
Human(23013) Summary: This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
Mouse(56381) SPEN homolog, transcriptional regulator (Drosophila)
Rat(365981) SPEN homolog, transcriptional regulator (Drosophila)
cow(513692) spen homolog, transcriptional regulator (Drosophila)
sheep(101108848) spen homolog, transcriptional regulator (Drosophila)
naked mole-rat(101710447) spen homolog, transcriptional regulator (Drosophila)
domestic guinea pig(100713290) spen homolog, transcriptional regulator (Drosophila)
fruit fly(44205) split ends
chicken(419460) spen homolog, transcriptional regulator (Drosophila)
Horse(100053790) spen homolog, transcriptional regulator (Drosophila)
domestic cat(101082674) spen homolog, transcriptional regulator (Drosophila)
dog(100687765) spen homolog, transcriptional regulator (Drosophila)
Zebrafish(503940) spen homolog, transcriptional regulator (Drosophila)
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015001 Rosetta Predictions human pricing
XM_345315 Rosetta Predictions rat pricing
NM_019763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346770 predicted 7761
2 SASI_Hs01_00240966 predicted 1550
3 SASI_Hs02_00346771 predicted 746
4 SASI_Hs01_00240967 predicted 1776
5 SASI_Hs01_00240970 predicted 3411
6 SASI_Hs01_00240971 predicted 4662
7 SASI_Hs01_00240972 predicted 1818
8 SASI_Hs01_00240973 predicted 4128
9 SASI_Hs02_00346772 predicted 580
10 SASI_Hs01_00240975 predicted 5509
11 SASI_Hs01_00240968 predicted 2113
12 SASI_Hs01_00240969 predicted 4461
13 SASI_Hs01_00240974 predicted 2073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398204 predicted 236
2 SASI_Rn02_00398205 predicted 226
3 SASI_Rn02_00398206 predicted 200
4 SASI_Rn02_00398207 predicted 232
5 SASI_Rn02_00398208 predicted 224
6 SASI_Rn02_00398209 predicted 345
7 SASI_Rn02_00398210 predicted 140
8 SASI_Rn02_00398211 predicted 183
9 SASI_Rn02_00398212 predicted 341
10 SASI_Rn02_00398213 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197834 predicted 1698
2 SASI_Mm01_00197835 predicted 2151
3 SASI_Mm01_00197836 predicted 4370
4 SASI_Mm02_00324942 predicted 3273
5 SASI_Mm01_00197837 predicted 6494
6 SASI_Mm01_00197839 predicted 1922
7 SASI_Mm02_00324943 predicted 2297
8 SASI_Mm01_00197840 predicted 1911
9 SASI_Mm01_00197842 predicted 2412
10 SASI_Mm01_00197843 predicted 893
11 SASI_Mm01_00197838 predicted 2150
12 SASI_Mm01_00197841 predicted 5964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019763
VALIDATED
SPEN MISSION shRNA Bacterial Glycerol Stock
spen homolog, transcriptional regulator (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-7749s1c1
Sequence:CCGGGCAGAAGATCACGTTGGCAAACTCGAGTTTGCCAACGTGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-1359s1c1
Sequence:CCGGCCTTGGAAATAACCGCCTCAACTCGAGTTGAGGCGGTTATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-4168s1c1
Sequence:CCGGGCTAGCTCTTTAGAAAGGAATCTCGAGATTCCTTTCTAAAGAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-149s1c1
Sequence:CCGGCGTCTCGTAGTAGAGAGGTTTCTCGAGAAACCTCTCTACTACGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-10161s1c1
Sequence:CCGGGCCATTGTTTGTCCCTGCAAACTCGAGTTTGCAGGGACAAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019763.2-11597s21c1
Sequence:GTACCGGGAACAGCCTTTGCACTAAATTCTCGAGAATTTAGTGCAAAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019763.2-12064s21c1
Sequence:GTACCGGACTTTGTACCGTCACTCATTTCTCGAGAAATGAGTGACGGTACAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019763.2-4302s21c1
Sequence:CCGGAGTGAGAGACGATCCATTAAACTCGAGTTTAATGGATCGTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019763.2-842s21c1
Sequence:CCGGATTACGATCAGGATTACTATACTCGAGTATAGTAATCCTGATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019763.2-568s21c1
Sequence:CCGGGACCTCCGCACGGATTATAATCTCGAGATTATAATCCGTGCGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019763
VALIDATED
SPEN MISSION shRNA shRNA Plasmid DNA
spen homolog, transcriptional regulator (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-7749s1c1
Sequence:CCGGGCAGAAGATCACGTTGGCAAACTCGAGTTTGCCAACGTGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-1359s1c1
Sequence:CCGGCCTTGGAAATAACCGCCTCAACTCGAGTTGAGGCGGTTATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-4168s1c1
Sequence:CCGGGCTAGCTCTTTAGAAAGGAATCTCGAGATTCCTTTCTAAAGAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-149s1c1
Sequence:CCGGCGTCTCGTAGTAGAGAGGTTTCTCGAGAAACCTCTCTACTACGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-10161s1c1
Sequence:CCGGGCCATTGTTTGTCCCTGCAAACTCGAGTTTGCAGGGACAAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019763.2-11597s21c1
Sequence:GTACCGGGAACAGCCTTTGCACTAAATTCTCGAGAATTTAGTGCAAAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019763.2-12064s21c1
Sequence:GTACCGGACTTTGTACCGTCACTCATTTCTCGAGAAATGAGTGACGGTACAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019763.2-4302s21c1
Sequence:CCGGAGTGAGAGACGATCCATTAAACTCGAGTTTAATGGATCGTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019763.2-842s21c1
Sequence:CCGGATTACGATCAGGATTACTATACTCGAGTATAGTAATCCTGATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019763.2-568s21c1
Sequence:CCGGGACCTCCGCACGGATTATAATCTCGAGATTATAATCCGTGCGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019763
VALIDATED
SPEN MISSION shRNA Lentiviral Transduction Particles
spen homolog, transcriptional regulator (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-7749s1c1
Sequence:CCGGGCAGAAGATCACGTTGGCAAACTCGAGTTTGCCAACGTGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-1359s1c1
Sequence:CCGGCCTTGGAAATAACCGCCTCAACTCGAGTTGAGGCGGTTATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-4168s1c1
Sequence:CCGGGCTAGCTCTTTAGAAAGGAATCTCGAGATTCCTTTCTAAAGAGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-149s1c1
Sequence:CCGGCGTCTCGTAGTAGAGAGGTTTCTCGAGAAACCTCTCTACTACGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019763.1-10161s1c1
Sequence:CCGGGCCATTGTTTGTCCCTGCAAACTCGAGTTTGCAGGGACAAACAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019763.2-11597s21c1
Sequence:GTACCGGGAACAGCCTTTGCACTAAATTCTCGAGAATTTAGTGCAAAGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019763.2-12064s21c1
Sequence:GTACCGGACTTTGTACCGTCACTCATTTCTCGAGAAATGAGTGACGGTACAAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019763.2-4302s21c1
Sequence:CCGGAGTGAGAGACGATCCATTAAACTCGAGTTTAATGGATCGTCTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019763.2-842s21c1
Sequence:CCGGATTACGATCAGGATTACTATACTCGAGTATAGTAATCCTGATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019763.2-568s21c1
Sequence:CCGGGACCTCCGCACGGATTATAATCTCGAGATTATAATCCGTGCGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015001
SPEN MISSION shRNA Bacterial Glycerol Stock
spen homolog, transcriptional regulator (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015001.2-11379s1c1
Sequence:CCGGGCTACCTTGTATGTTTACATACTCGAGTATGTAAACATACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-1828s1c1
Sequence:CCGGCCTGTGGTAAAGGTGGTGTTTCTCGAGAAACACCACCTTTACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-6861s1c1
Sequence:CCGGCGGCTCCATCATCAATGACATCTCGAGATGTCATTGATGATGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-2092s1c1
Sequence:CCGGCGTACATATTATGAGAGTGTTCTCGAGAACACTCTCATAATATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-10687s1c1
Sequence:CCGGCCCGTGGATATGGTTCAACTTCTCGAGAAGTTGAACCATATCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-695s21c1
Sequence:CCGGATTACGATCAGGATTACTATACTCGAGTATAGTAATCCTGATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-421s21c1
Sequence:CCGGGACCTACGCACGGATTATAATCTCGAGATTATAATCCGTGCGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015001.2-11735s21c1
Sequence:CCGGCATTTGGATGCGTCACCTTAACTCGAGTTAAGGTGACGCATCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-1666s21c1
Sequence:CCGGAGCGTTTGTAAAGCTATTAAGCTCGAGCTTAATAGCTTTACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-2080s21c1
Sequence:CCGGTATAACCAAGATCGTACATATCTCGAGATATGTACGATCTTGGTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015001
SPEN MISSION shRNA shRNA Plasmid DNA
spen homolog, transcriptional regulator (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015001.2-11379s1c1
Sequence:CCGGGCTACCTTGTATGTTTACATACTCGAGTATGTAAACATACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-1828s1c1
Sequence:CCGGCCTGTGGTAAAGGTGGTGTTTCTCGAGAAACACCACCTTTACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-6861s1c1
Sequence:CCGGCGGCTCCATCATCAATGACATCTCGAGATGTCATTGATGATGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-2092s1c1
Sequence:CCGGCGTACATATTATGAGAGTGTTCTCGAGAACACTCTCATAATATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-10687s1c1
Sequence:CCGGCCCGTGGATATGGTTCAACTTCTCGAGAAGTTGAACCATATCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-695s21c1
Sequence:CCGGATTACGATCAGGATTACTATACTCGAGTATAGTAATCCTGATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-421s21c1
Sequence:CCGGGACCTACGCACGGATTATAATCTCGAGATTATAATCCGTGCGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015001.2-11735s21c1
Sequence:CCGGCATTTGGATGCGTCACCTTAACTCGAGTTAAGGTGACGCATCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-1666s21c1
Sequence:CCGGAGCGTTTGTAAAGCTATTAAGCTCGAGCTTAATAGCTTTACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-2080s21c1
Sequence:CCGGTATAACCAAGATCGTACATATCTCGAGATATGTACGATCTTGGTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015001
SPEN MISSION shRNA Lentiviral Transduction Particles
spen homolog, transcriptional regulator (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015001.2-11379s1c1
Sequence:CCGGGCTACCTTGTATGTTTACATACTCGAGTATGTAAACATACAAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-1828s1c1
Sequence:CCGGCCTGTGGTAAAGGTGGTGTTTCTCGAGAAACACCACCTTTACCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-6861s1c1
Sequence:CCGGCGGCTCCATCATCAATGACATCTCGAGATGTCATTGATGATGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-2092s1c1
Sequence:CCGGCGTACATATTATGAGAGTGTTCTCGAGAACACTCTCATAATATGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015001.2-10687s1c1
Sequence:CCGGCCCGTGGATATGGTTCAACTTCTCGAGAAGTTGAACCATATCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-695s21c1
Sequence:CCGGATTACGATCAGGATTACTATACTCGAGTATAGTAATCCTGATCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-421s21c1
Sequence:CCGGGACCTACGCACGGATTATAATCTCGAGATTATAATCCGTGCGTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015001.2-11735s21c1
Sequence:CCGGCATTTGGATGCGTCACCTTAACTCGAGTTAAGGTGACGCATCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-1666s21c1
Sequence:CCGGAGCGTTTGTAAAGCTATTAAGCTCGAGCTTAATAGCTTTACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015001.2-2080s21c1
Sequence:CCGGTATAACCAAGATCGTACATATCTCGAGATATGTACGATCTTGGTTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks