EMAIL THIS PAGE TO A FRIEND

SPERT

spermatid associated

Synonyms: CBY2 NURIT
UniProtKB ID: Q8NA61, A8K8I5, Q8NHV2
Gene ID:
Mouse(67926) spermatid associated
Rat(498572) spermatid associated
domestic guinea pig(100716769) spermatid associated
naked mole-rat(101713312) spermatid associated
cow(616053) spermatid associated
sheep(101103822) spermatid associated
chicken(418848) spermatid associated
dog(476922) spermatid associated
domestic cat(101082618) spermatid associated
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152719 Rosetta Predictions human pricing
NM_001017506 Rosetta Predictions rat pricing
NM_026457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034169 predicted 1058
2 SASI_Hs01_00034170 predicted 1369
3 SASI_Hs01_00034171 predicted 343
4 SASI_Hs01_00034173 predicted 874
5 SASI_Hs01_00034174 predicted 1339
6 SASI_Hs01_00034175 predicted 1347
7 SASI_Hs01_00034176 predicted 1227
8 SASI_Hs02_00366622 predicted 1280
9 SASI_Hs01_00034177 predicted 532
10 SASI_Hs01_00034178 predicted 1058
11 SASI_Hs01_00034172 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077063 predicted 779
2 SASI_Rn01_00077064 predicted 955
3 SASI_Rn01_00077065 predicted 716
4 SASI_Rn01_00077066 predicted 562
5 SASI_Rn01_00077067 predicted 1185
6 SASI_Rn01_00077069 predicted 1279
7 SASI_Rn01_00077070 predicted 776
8 SASI_Rn01_00077071 predicted 1313
9 SASI_Rn01_00077072 predicted 418
10 SASI_Rn02_00202335 predicted 402
11 SASI_Rn01_00077068 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029710 predicted 1027
2 SASI_Mm01_00029711 predicted 867
3 SASI_Mm01_00029712 predicted 1117
4 SASI_Mm01_00029714 predicted 739
5 SASI_Mm01_00029715 predicted 564
6 SASI_Mm01_00029716 predicted 621
7 SASI_Mm01_00029717 predicted 607
8 SASI_Mm01_00029718 predicted 398
9 SASI_Mm01_00029719 predicted 677
10 SASI_Mm02_00330314 predicted 739
11 SASI_Mm01_00029713 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152719
SPERT MISSION shRNA Bacterial Glycerol Stock
spermatid associated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-213s1c1
Sequence:CCGGCCAATCAGTGTGGTTCTACCTCTCGAGAGGTAGAACCACACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-126s1c1
Sequence:CCGGCATAGGACCTATACCTGGCAACTCGAGTTGCCAGGTATAGGTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-1286s1c1
Sequence:CCGGGAACAACAAGCTGAAGCTGCACTCGAGTGCAGCTTCAGCTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-656s1c1
Sequence:CCGGGAACAAGATCCTACAGGTCTTCTCGAGAAGACCTGTAGGATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-641s1c1
Sequence:CCGGGATGCTCAGCAAGGAGAACAACTCGAGTTGTTCTCCTTGCTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-143s1c1
Sequence:CCGGGCAACTCACATTGCACTCAAGCTCGAGCTTGAGTGCAATGTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-196s1c1
Sequence:CCGGCTGAAAGCCTAGAAATTCCAACTCGAGTTGGAATTTCTAGGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-191s1c1
Sequence:CCGGCAGATCTGAAAGCCTAGAAATCTCGAGATTTCTAGGCTTTCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-160s1c1
Sequence:CCGGCAAGGCCAAATTATACAAGAACTCGAGTTCTTGTATAATTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-207s1c1
Sequence:CCGGGAAATTCCAATCAGTGTGGTTCTCGAGAACCACACTGATTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152719
SPERT MISSION shRNA shRNA Plasmid DNA
spermatid associated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-213s1c1
Sequence:CCGGCCAATCAGTGTGGTTCTACCTCTCGAGAGGTAGAACCACACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-126s1c1
Sequence:CCGGCATAGGACCTATACCTGGCAACTCGAGTTGCCAGGTATAGGTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-1286s1c1
Sequence:CCGGGAACAACAAGCTGAAGCTGCACTCGAGTGCAGCTTCAGCTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-656s1c1
Sequence:CCGGGAACAAGATCCTACAGGTCTTCTCGAGAAGACCTGTAGGATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-641s1c1
Sequence:CCGGGATGCTCAGCAAGGAGAACAACTCGAGTTGTTCTCCTTGCTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-143s1c1
Sequence:CCGGGCAACTCACATTGCACTCAAGCTCGAGCTTGAGTGCAATGTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-196s1c1
Sequence:CCGGCTGAAAGCCTAGAAATTCCAACTCGAGTTGGAATTTCTAGGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-191s1c1
Sequence:CCGGCAGATCTGAAAGCCTAGAAATCTCGAGATTTCTAGGCTTTCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-160s1c1
Sequence:CCGGCAAGGCCAAATTATACAAGAACTCGAGTTCTTGTATAATTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-207s1c1
Sequence:CCGGGAAATTCCAATCAGTGTGGTTCTCGAGAACCACACTGATTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152719
SPERT MISSION shRNA Lentiviral Transduction Particles
spermatid associated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-213s1c1
Sequence:CCGGCCAATCAGTGTGGTTCTACCTCTCGAGAGGTAGAACCACACTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-126s1c1
Sequence:CCGGCATAGGACCTATACCTGGCAACTCGAGTTGCCAGGTATAGGTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-1286s1c1
Sequence:CCGGGAACAACAAGCTGAAGCTGCACTCGAGTGCAGCTTCAGCTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-656s1c1
Sequence:CCGGGAACAAGATCCTACAGGTCTTCTCGAGAAGACCTGTAGGATCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-641s1c1
Sequence:CCGGGATGCTCAGCAAGGAGAACAACTCGAGTTGTTCTCCTTGCTGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165047    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-143s1c1
Sequence:CCGGGCAACTCACATTGCACTCAAGCTCGAGCTTGAGTGCAATGTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-196s1c1
Sequence:CCGGCTGAAAGCCTAGAAATTCCAACTCGAGTTGGAATTTCTAGGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-191s1c1
Sequence:CCGGCAGATCTGAAAGCCTAGAAATCTCGAGATTTCTAGGCTTTCAGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-160s1c1
Sequence:CCGGCAAGGCCAAATTATACAAGAACTCGAGTTCTTGTATAATTTGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152719.1-207s1c1
Sequence:CCGGGAAATTCCAATCAGTGTGGTTCTCGAGAACCACACTGATTGGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026457
SPERT MISSION shRNA Bacterial Glycerol Stock
spermatid associated
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-575s1c1
Sequence:CCGGGAAGAGAGACAACACCACTTTCTCGAGAAAGTGGTGTTGTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-260s1c1
Sequence:CCGGCAGCGATGAGATGTTTGTCTTCTCGAGAAGACAAACATCTCATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026457.1-1160s1c1
Sequence:CCGGGATGCTTATCGAAGAGCTGTACTCGAGTACAGCTCTTCGATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-530s1c1
Sequence:CCGGGACCTCCTCATTGTTGCACAACTCGAGTTGTGCAACAATGAGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026457.1-1247s1c1
Sequence:CCGGCAGACATAGACACCAAGACCACTCGAGTGGTCTTGGTGTCTATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026457.1-396s1c1
Sequence:CCGGCAGGAAGAGAACAAGTCTCTTCTCGAGAAGAGACTTGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026457.1-1244s1c1
Sequence:CCGGCAGCAGACATAGACACCAAGACTCGAGTCTTGGTGTCTATGTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-313s1c1
Sequence:CCGGGCCTACAACCACCTTACTTCTCTCGAGAGAAGTAAGGTGGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026457
SPERT MISSION shRNA shRNA Plasmid DNA
spermatid associated
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-575s1c1
Sequence:CCGGGAAGAGAGACAACACCACTTTCTCGAGAAAGTGGTGTTGTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-260s1c1
Sequence:CCGGCAGCGATGAGATGTTTGTCTTCTCGAGAAGACAAACATCTCATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026457.1-1160s1c1
Sequence:CCGGGATGCTTATCGAAGAGCTGTACTCGAGTACAGCTCTTCGATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-530s1c1
Sequence:CCGGGACCTCCTCATTGTTGCACAACTCGAGTTGTGCAACAATGAGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026457.1-1247s1c1
Sequence:CCGGCAGACATAGACACCAAGACCACTCGAGTGGTCTTGGTGTCTATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026457.1-396s1c1
Sequence:CCGGCAGGAAGAGAACAAGTCTCTTCTCGAGAAGAGACTTGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026457.1-1244s1c1
Sequence:CCGGCAGCAGACATAGACACCAAGACTCGAGTCTTGGTGTCTATGTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-313s1c1
Sequence:CCGGGCCTACAACCACCTTACTTCTCTCGAGAGAAGTAAGGTGGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026457
SPERT MISSION shRNA Lentiviral Transduction Particles
spermatid associated
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-575s1c1
Sequence:CCGGGAAGAGAGACAACACCACTTTCTCGAGAAAGTGGTGTTGTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-260s1c1
Sequence:CCGGCAGCGATGAGATGTTTGTCTTCTCGAGAAGACAAACATCTCATCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026457.1-1160s1c1
Sequence:CCGGGATGCTTATCGAAGAGCTGTACTCGAGTACAGCTCTTCGATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-530s1c1
Sequence:CCGGGACCTCCTCATTGTTGCACAACTCGAGTTGTGCAACAATGAGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026457.1-1247s1c1
Sequence:CCGGCAGACATAGACACCAAGACCACTCGAGTGGTCTTGGTGTCTATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026457.1-396s1c1
Sequence:CCGGCAGGAAGAGAACAAGTCTCTTCTCGAGAAGAGACTTGTTCTCTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026457.1-1244s1c1
Sequence:CCGGCAGCAGACATAGACACCAAGACTCGAGTCTTGGTGTCTATGTCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026457.1-313s1c1
Sequence:CCGGGCCTACAACCACCTTACTTCTCTCGAGAGAAGTAAGGTGGTTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks