EMAIL THIS PAGE TO A FRIEND

SPESP1

sperm equatorial segment protein 1

Synonyms: ESP SP-ESP
UniProtKB ID: Q6UW49, Q8NG22, Q8WVH8
Gene ID:
Human(246777) Summary: The encoded protein is a human alloantigen involved in sperm-egg binding and fusion. [provided by RefSeq, Apr 2010]
Mouse(66712) sperm equatorial segment protein 1
Rat(501010) sperm equatorial segment protein 1
domestic cat(101099212) sperm equatorial segment protein 1
dog(100684111) sperm equatorial segment protein 1
Horse(100064996) sperm equatorial segment protein 1
cow(513571) sperm equatorial segment protein 1
sheep(101106331) sperm equatorial segment protein 1
naked mole-rat(101709773) sperm equatorial segment protein 1
domestic guinea pig(100731258) sperm equatorial segment protein 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145658 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145658 Rosetta Predictions human pricing
NM_001077682 Rosetta Predictions rat pricing
NM_025721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240246 predicted 521
2 SASI_Hs02_00365281 predicted 660
3 SASI_Hs01_00240247 predicted 438
4 SASI_Hs01_00240248 predicted 527
5 SASI_Hs01_00240250 predicted 606
6 SASI_Hs01_00240251 predicted 861
7 SASI_Hs01_00240252 predicted 221
8 SASI_Hs01_00240253 predicted 827
9 SASI_Hs01_00240254 predicted 411
10 SASI_Hs01_00240255 predicted 659
11 SASI_Hs01_00240249 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207939 predicted 1331
2 SASI_Rn02_00207940 predicted 462
3 SASI_Rn02_00207941 predicted 932
4 SASI_Rn02_00207942 predicted 1016
5 SASI_Rn02_00207943 predicted 827
6 SASI_Rn02_00207944 predicted 773
7 SASI_Rn02_00207945 predicted 243
8 SASI_Rn02_00207946 predicted 1293
9 SASI_Rn02_00207947 predicted 224
10 SASI_Rn02_00207948 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086822 predicted 1048
2 SASI_Mm01_00086823 predicted 488
3 SASI_Mm01_00086824 predicted 414
4 SASI_Mm01_00086825 predicted 1262
5 SASI_Mm01_00086826 predicted 1136
6 SASI_Mm01_00086827 predicted 902
7 SASI_Mm01_00086828 predicted 428
8 SASI_Mm01_00086829 predicted 1094
9 SASI_Mm01_00086830 predicted 1201
10 SASI_Mm01_00086831 predicted 696
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025721
SPESP1 MISSION shRNA Bacterial Glycerol Stock
sperm equatorial segment protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-193s1c1
Sequence:CCGGGCCCGATGAAGAGCAGAATTTCTCGAGAAATTCTGCTCTTCATCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-1134s1c1
Sequence:CCGGCCAGGTCCAAGTTGTCAGATTCTCGAGAATCTGACAACTTGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-518s1c1
Sequence:CCGGCGCACGGAGGAACCATTTATTCTCGAGAATAAATGGTTCCTCCGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-491s1c1
Sequence:CCGGCGGCCAAACAATATTTCTGTTCTCGAGAACAGAAATATTGTTTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025721
SPESP1 MISSION shRNA shRNA Plasmid DNA
sperm equatorial segment protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-193s1c1
Sequence:CCGGGCCCGATGAAGAGCAGAATTTCTCGAGAAATTCTGCTCTTCATCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-1134s1c1
Sequence:CCGGCCAGGTCCAAGTTGTCAGATTCTCGAGAATCTGACAACTTGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-518s1c1
Sequence:CCGGCGCACGGAGGAACCATTTATTCTCGAGAATAAATGGTTCCTCCGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-491s1c1
Sequence:CCGGCGGCCAAACAATATTTCTGTTCTCGAGAACAGAAATATTGTTTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025721
SPESP1 MISSION shRNA Lentiviral Transduction Particles
sperm equatorial segment protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-193s1c1
Sequence:CCGGGCCCGATGAAGAGCAGAATTTCTCGAGAAATTCTGCTCTTCATCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-1134s1c1
Sequence:CCGGCCAGGTCCAAGTTGTCAGATTCTCGAGAATCTGACAACTTGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-518s1c1
Sequence:CCGGCGCACGGAGGAACCATTTATTCTCGAGAATAAATGGTTCCTCCGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025721.1-491s1c1
Sequence:CCGGCGGCCAAACAATATTTCTGTTCTCGAGAACAGAAATATTGTTTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145658
SPESP1 MISSION shRNA Bacterial Glycerol Stock
sperm equatorial segment protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-736s1c1
Sequence:CCGGCAGGTGAAACTGCGATAGAAACTCGAGTTTCTATCGCAGTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-615s1c1
Sequence:CCGGCCAGTTGTTACTGAATCATCTCTCGAGAGATGATTCAGTAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145658.1-1227s1c1
Sequence:CCGGGCTGATTTAAGCAAACTGCATCTCGAGATGCAGTTTGCTTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-604s1c1
Sequence:CCGGCAAGAATGTTGCCAGTTGTTACTCGAGTAACAACTGGCAACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-780s1c1
Sequence:CCGGCCAGAGAGTTGGAATAATGATCTCGAGATCATTATTCCAACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-603s1c1
Sequence:CCGGCCAAGAATGTTGCCAGTTGTTCTCGAGAACAACTGGCAACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-249s1c1
Sequence:CCGGGAGAACCTAGTACGAAGTGTTCTCGAGAACACTTCGTACTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-694s1c1
Sequence:CCGGGCATTGGGATCTCTACAGAATCTCGAGATTCTGTAGAGATCCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-625s1c1
Sequence:CCGGCTGAATCATCTACAAGTCCATCTCGAGATGGACTTGTAGATGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-891s1c1
Sequence:CCGGGAAGCCTCTAAAGATCACCTACTCGAGTAGGTGATCTTTAGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-491s1c1
Sequence:CCGGCTGGTCGATCAAACCAAACAACTCGAGTTGTTTGGTTTGATCGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-374s1c1
Sequence:CCGGCGCTTCAACTGAGAATGATGTCTCGAGACATCATTCTCAGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145658
SPESP1 MISSION shRNA shRNA Plasmid DNA
sperm equatorial segment protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-736s1c1
Sequence:CCGGCAGGTGAAACTGCGATAGAAACTCGAGTTTCTATCGCAGTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-615s1c1
Sequence:CCGGCCAGTTGTTACTGAATCATCTCTCGAGAGATGATTCAGTAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145658.1-1227s1c1
Sequence:CCGGGCTGATTTAAGCAAACTGCATCTCGAGATGCAGTTTGCTTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-604s1c1
Sequence:CCGGCAAGAATGTTGCCAGTTGTTACTCGAGTAACAACTGGCAACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-780s1c1
Sequence:CCGGCCAGAGAGTTGGAATAATGATCTCGAGATCATTATTCCAACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-603s1c1
Sequence:CCGGCCAAGAATGTTGCCAGTTGTTCTCGAGAACAACTGGCAACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-249s1c1
Sequence:CCGGGAGAACCTAGTACGAAGTGTTCTCGAGAACACTTCGTACTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-694s1c1
Sequence:CCGGGCATTGGGATCTCTACAGAATCTCGAGATTCTGTAGAGATCCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-625s1c1
Sequence:CCGGCTGAATCATCTACAAGTCCATCTCGAGATGGACTTGTAGATGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-891s1c1
Sequence:CCGGGAAGCCTCTAAAGATCACCTACTCGAGTAGGTGATCTTTAGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-491s1c1
Sequence:CCGGCTGGTCGATCAAACCAAACAACTCGAGTTGTTTGGTTTGATCGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-374s1c1
Sequence:CCGGCGCTTCAACTGAGAATGATGTCTCGAGACATCATTCTCAGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145658
SPESP1 MISSION shRNA Lentiviral Transduction Particles
sperm equatorial segment protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-736s1c1
Sequence:CCGGCAGGTGAAACTGCGATAGAAACTCGAGTTTCTATCGCAGTTTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-615s1c1
Sequence:CCGGCCAGTTGTTACTGAATCATCTCTCGAGAGATGATTCAGTAACAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145658.1-1227s1c1
Sequence:CCGGGCTGATTTAAGCAAACTGCATCTCGAGATGCAGTTTGCTTAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-604s1c1
Sequence:CCGGCAAGAATGTTGCCAGTTGTTACTCGAGTAACAACTGGCAACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-780s1c1
Sequence:CCGGCCAGAGAGTTGGAATAATGATCTCGAGATCATTATTCCAACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-603s1c1
Sequence:CCGGCCAAGAATGTTGCCAGTTGTTCTCGAGAACAACTGGCAACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145658.1-249s1c1
Sequence:CCGGGAGAACCTAGTACGAAGTGTTCTCGAGAACACTTCGTACTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-694s1c1
Sequence:CCGGGCATTGGGATCTCTACAGAATCTCGAGATTCTGTAGAGATCCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-625s1c1
Sequence:CCGGCTGAATCATCTACAAGTCCATCTCGAGATGGACTTGTAGATGATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-891s1c1
Sequence:CCGGGAAGCCTCTAAAGATCACCTACTCGAGTAGGTGATCTTTAGAGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153616    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-491s1c1
Sequence:CCGGCTGGTCGATCAAACCAAACAACTCGAGTTGTTTGGTTTGATCGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145658.1-374s1c1
Sequence:CCGGCGCTTCAACTGAGAATGATGTCTCGAGACATCATTCTCAGTTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks