EMAIL THIS PAGE TO A FRIEND

SPG11

spastic paraplegia 11 (autosomal recessive)

Synonyms: KIAA1840
Gene ID:
Human(80208) Summary: The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(214585) spastic paraplegia 11
Rat(311372) spastic paraplegia 11 (autosomal recessive)
Zebrafish(793551) spastic paraplegia 11
domestic cat(101093692) spastic paraplegia 11 (autosomal recessive)
dog(487533) spastic paraplegia 11 (autosomal recessive)
chicken(415572) spastic paraplegia 11 (autosomal recessive)
domestic guinea pig(100719807) spastic paraplegia 11 (autosomal recessive)
naked mole-rat(101701583) spastic paraplegia 11 (autosomal recessive)
Domestic Rabbit(100357157) spastic paraplegia 11 (autosomal recessive)
cow(507819) spastic paraplegia 11 (autosomal recessive)
sheep(101116484) spastic paraplegia 11 (autosomal recessive)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025137 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025137 Rosetta Predictions human pricing
XM_242139 Rosetta Predictions rat pricing
XR_009601 Rosetta Predictions rat pricing
XM_904251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095594 predicted 2001
2 SASI_Hs01_00095595 predicted 1976
3 SASI_Hs02_00357860 predicted 6232
4 SASI_Hs01_00095596 predicted 5891
5 SASI_Hs01_00095597 predicted 1850
6 SASI_Hs01_00095598 predicted 5704
7 SASI_Hs01_00095599 predicted 4029
8 SASI_Hs01_00095600 predicted 1770
9 SASI_Hs01_00095601 predicted 5067
10 SASI_Hs01_00095602 predicted 3464
11 SASI_Hs01_00095603 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_242139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391669 predicted 7110
2 SASI_Rn02_00391670 predicted 7025
3 SASI_Rn02_00391671 predicted 7427
4 SASI_Rn02_00391672 predicted 6438
5 SASI_Rn02_00391673 predicted 7279
6 SASI_Rn02_00391674 predicted 7295
7 SASI_Rn02_00391675 predicted 3682
8 SASI_Rn02_00391676 predicted 596
9 SASI_Rn02_00391677 predicted 1677
10 SASI_Rn02_00391678 predicted 4055
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165136 predicted 9113
2 SASI_Rn01_00165137 predicted 6990
3 SASI_Rn02_00420233 predicted 9173
4 SASI_Rn01_00165138 predicted 6395
5 SASI_Rn01_00165139 predicted 7241
6 SASI_Rn02_00420234 predicted 7254
7 SASI_Rn01_00165140 predicted 3647
8 SASI_Rn01_00165142 predicted 597
9 SASI_Rn01_00165143 predicted 1681
10 SASI_Rn01_00165144 predicted 4023
11 SASI_Rn01_00165141 predicted 7937
12 SASI_Rn01_00165145 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430766 predicted 665
2 SASI_Mm02_00430767 predicted 522
3 SASI_Mm02_00430768 predicted 838
4 SASI_Mm02_00430769 predicted 425
5 SASI_Mm02_00430770 predicted 794
6 SASI_Mm02_00430771 predicted 533
7 SASI_Mm02_00430772 predicted 204
8 SASI_Mm02_00430773 predicted 581
9 SASI_Mm02_00430774 predicted 693
10 SASI_Mm02_00430775 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025137
VALIDATED
SPG11 MISSION shRNA Bacterial Glycerol Stock
spastic paraplegia 11 (autosomal recessive)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7402s1c1
Sequence:CCGGGCATTGGAGATCTTTGCTAAACTCGAGTTTAGCAAAGATCTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025137.2-3652s1c1
Sequence:CCGGCCAGGAATTAATCAAGAGCAACTCGAGTTGCTCTTGATTAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-5907s1c1
Sequence:CCGGCCAGTAATGAAGTGGTAACTACTCGAGTAGTTACCACTTCATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025137.2-2604s1c1
Sequence:CCGGCCAGGATAAGTCCAGAAGAATCTCGAGATTCTTCTGGACTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-6719s1c1
Sequence:CCGGCGCATCCAACTGAAATTGATTCTCGAGAATCAATTTCAGTTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-2024s1c1
Sequence:CCGGCCCAAAGTAAAGGAGAGCAATCTCGAGATTGCTCTCCTTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7589s1c1
Sequence:CCGGCCTCAGGACAGCTTCTACTTTCTCGAGAAAGTAGAAGCTGTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025137.2-1773s1c1
Sequence:CCGGGCTCGGCAATTAGAGAAAGTTCTCGAGAACTTTCTCTAATTGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025137.2-7369s1c1
Sequence:CCGGGCAGATTCTGACAGATGTGATCTCGAGATCACATCTGTCAGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7434s1c1
Sequence:CCGGCCGGTACTGTACCATATCAGTCTCGAGACTGATATGGTACAGTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-2054s21c1
Sequence:CCGGCCCAAAGTAAAGGAGAGCAATCTCGAGATTGCTCTCCTTTACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-1201s21c1
Sequence:CCGGCATAATGCATGGGCAATATAACTCGAGTTATATTGCCCATGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025137.3-2194s21c1
Sequence:CCGGTATTGGCATAGGCCTAAATTTCTCGAGAAATTTAGGCCTATGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-2924s21c1
Sequence:CCGGAGCCGTATTGGAGGTGTAATACTCGAGTATTACACCTCCAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025137.3-7427s21c1
Sequence:CCGGAGAATGCATTGGAGATCTTTGCTCGAGCAAAGATCTCCAATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025137
VALIDATED
SPG11 MISSION shRNA shRNA Plasmid DNA
spastic paraplegia 11 (autosomal recessive)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7402s1c1
Sequence:CCGGGCATTGGAGATCTTTGCTAAACTCGAGTTTAGCAAAGATCTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025137.2-3652s1c1
Sequence:CCGGCCAGGAATTAATCAAGAGCAACTCGAGTTGCTCTTGATTAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-5907s1c1
Sequence:CCGGCCAGTAATGAAGTGGTAACTACTCGAGTAGTTACCACTTCATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025137.2-2604s1c1
Sequence:CCGGCCAGGATAAGTCCAGAAGAATCTCGAGATTCTTCTGGACTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-6719s1c1
Sequence:CCGGCGCATCCAACTGAAATTGATTCTCGAGAATCAATTTCAGTTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-2024s1c1
Sequence:CCGGCCCAAAGTAAAGGAGAGCAATCTCGAGATTGCTCTCCTTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7589s1c1
Sequence:CCGGCCTCAGGACAGCTTCTACTTTCTCGAGAAAGTAGAAGCTGTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025137.2-1773s1c1
Sequence:CCGGGCTCGGCAATTAGAGAAAGTTCTCGAGAACTTTCTCTAATTGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025137.2-7369s1c1
Sequence:CCGGGCAGATTCTGACAGATGTGATCTCGAGATCACATCTGTCAGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7434s1c1
Sequence:CCGGCCGGTACTGTACCATATCAGTCTCGAGACTGATATGGTACAGTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-2054s21c1
Sequence:CCGGCCCAAAGTAAAGGAGAGCAATCTCGAGATTGCTCTCCTTTACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-1201s21c1
Sequence:CCGGCATAATGCATGGGCAATATAACTCGAGTTATATTGCCCATGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025137.3-2194s21c1
Sequence:CCGGTATTGGCATAGGCCTAAATTTCTCGAGAAATTTAGGCCTATGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-2924s21c1
Sequence:CCGGAGCCGTATTGGAGGTGTAATACTCGAGTATTACACCTCCAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025137.3-7427s21c1
Sequence:CCGGAGAATGCATTGGAGATCTTTGCTCGAGCAAAGATCTCCAATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025137
VALIDATED
SPG11 MISSION shRNA Lentiviral Transduction Particles
spastic paraplegia 11 (autosomal recessive)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150189    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7402s1c1
Sequence:CCGGGCATTGGAGATCTTTGCTAAACTCGAGTTTAGCAAAGATCTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025137.2-3652s1c1
Sequence:CCGGCCAGGAATTAATCAAGAGCAACTCGAGTTGCTCTTGATTAATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-5907s1c1
Sequence:CCGGCCAGTAATGAAGTGGTAACTACTCGAGTAGTTACCACTTCATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025137.2-2604s1c1
Sequence:CCGGCCAGGATAAGTCCAGAAGAATCTCGAGATTCTTCTGGACTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-6719s1c1
Sequence:CCGGCGCATCCAACTGAAATTGATTCTCGAGAATCAATTTCAGTTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025137.2-2024s1c1
Sequence:CCGGCCCAAAGTAAAGGAGAGCAATCTCGAGATTGCTCTCCTTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7589s1c1
Sequence:CCGGCCTCAGGACAGCTTCTACTTTCTCGAGAAAGTAGAAGCTGTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025137.2-1773s1c1
Sequence:CCGGGCTCGGCAATTAGAGAAAGTTCTCGAGAACTTTCTCTAATTGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025137.2-7369s1c1
Sequence:CCGGGCAGATTCTGACAGATGTGATCTCGAGATCACATCTGTCAGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025137.2-7434s1c1
Sequence:CCGGCCGGTACTGTACCATATCAGTCTCGAGACTGATATGGTACAGTACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-2054s21c1
Sequence:CCGGCCCAAAGTAAAGGAGAGCAATCTCGAGATTGCTCTCCTTTACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-1201s21c1
Sequence:CCGGCATAATGCATGGGCAATATAACTCGAGTTATATTGCCCATGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025137.3-2194s21c1
Sequence:CCGGTATTGGCATAGGCCTAAATTTCTCGAGAAATTTAGGCCTATGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025137.3-2924s21c1
Sequence:CCGGAGCCGTATTGGAGGTGTAATACTCGAGTATTACACCTCCAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025137.3-7427s21c1
Sequence:CCGGAGAATGCATTGGAGATCTTTGCTCGAGCAAAGATCTCCAATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks